header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-170518-2
Morpholino Name: MO2-bmp5
Target: bmp5 (1)
Sequence:
5' - TTGACCAGGATGATGATGCTTTCAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-bmp5 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-bmp5
Expressed Gene Anatomy Figures
dlx2a Fig. 2Fig. 3Fig. 4Fig. 5Fig. 6 from Shih et al., 2017
foxd3 Fig. 3 from Shih et al., 2017
id3 Fig. 6 from Shih et al., 2017
mbpa Fig. 3 from Shih et al., 2017
mitfa Fig. 3 from Shih et al., 2017
msx1b Fig. 4 from Shih et al., 2017
neurod1 Fig. 3 from Shih et al., 2017
sox10 Fig. 2Fig. 4Fig. 5Fig. 6 from Shih et al., 2017
PHENOTYPE
Phenotype resulting from MO2-bmp5
Phenotype Figures
embryonic viscerocranium morphogenesis decreased occurrence, abnormal Fig. 3 from Shih et al., 2017
glial cell foxd3 expression decreased amount, abnormal Fig. 3 from Shih et al., 2017
melanocyte mitfa expression decreased amount, abnormal Fig. 3 from Shih et al., 2017
melanocyte decreased amount, abnormal Fig. 3 from Shih et al., 2017
mesenchymal cell dlx2a expression decreased amount, abnormal Fig. 3 from Shih et al., 2017
neural crest sox10 expression decreased amount, abnormal Fig. 2Fig. 4Fig. 5Fig. 6 from Shih et al., 2017
neural crest dlx2a expression decreased amount, abnormal Fig. 2Fig. 4Fig. 5Fig. 6 from Shih et al., 2017
neural crest msx1b expression decreased amount, abnormal Fig. 4 from Shih et al., 2017
neural crest apoptotic process increased occurrence, abnormal Fig. 2Fig. 4 from Shih et al., 2017
neural crest cell population proliferation decreased occurrence, abnormal Fig. 2Fig. 5 from Shih et al., 2017
neural crest cell development decreased occurrence, abnormal Fig. 2Fig. 3Fig. 4Fig. 5 from Shih et al., 2017
neuron neurod1 expression decreased amount, abnormal Fig. 3 from Shih et al., 2017
perineuronal satellite cell mbpa expression decreased amount, abnormal Fig. 3 from Shih et al., 2017
perineuronal satellite cell decreased amount, abnormal Fig. 3 from Shih et al., 2017
whole organism id3 expression decreased amount, abnormal Fig. 6 from Shih et al., 2017
whole organism dlx2a expression decreased amount, abnormal Fig. 2Fig. 3Fig. 4Fig. 5 from Shih et al., 2017
whole organism foxd3 expression decreased amount, abnormal Fig. 3 from Shih et al., 2017
whole organism msx1b expression decreased amount, abnormal Fig. 4 from Shih et al., 2017
whole organism neurod1 expression decreased amount, abnormal Fig. 3 from Shih et al., 2017
whole organism sox10 expression decreased amount, abnormal Fig. 2Fig. 4Fig. 5 from Shih et al., 2017
whole organism mitfa expression decreased amount, abnormal Fig. 3 from Shih et al., 2017
whole organism anterior region id3 expression decreased amount, abnormal Fig. 6 from Shih et al., 2017

Phenotype of all Fish created by or utilizing MO2-bmp5
Phenotype Fish Conditions Figures
glial cell foxd3 expression decreased amount, abnormal TU + MO2-bmp5 standard conditions Fig. 3 from Shih et al., 2017
whole organism id3 expression decreased amount, abnormal TU + MO2-bmp5 standard conditions Fig. 6 from Shih et al., 2017
melanocyte decreased amount, abnormal TU + MO2-bmp5 standard conditions Fig. 3 from Shih et al., 2017
neural crest apoptotic process increased occurrence, abnormal TU + MO2-bmp5 standard conditions Fig. 2Fig. 4 from Shih et al., 2017
perineuronal satellite cell decreased amount, abnormal TU + MO2-bmp5 standard conditions Fig. 3 from Shih et al., 2017
whole organism anterior region id3 expression decreased amount, abnormal TU + MO2-bmp5 standard conditions Fig. 6 from Shih et al., 2017
neural crest dlx2a expression decreased amount, abnormal TU + MO2-bmp5 standard conditions Fig. 2Fig. 4Fig. 5Fig. 6 from Shih et al., 2017
mesenchymal cell dlx2a expression decreased amount, abnormal TU + MO2-bmp5 standard conditions Fig. 3 from Shih et al., 2017
neural crest cell development decreased occurrence, abnormal TU + MO2-bmp5 standard conditions Fig. 2Fig. 3Fig. 4Fig. 5 from Shih et al., 2017
neuron neurod1 expression decreased amount, abnormal TU + MO2-bmp5 standard conditions Fig. 3 from Shih et al., 2017
embryonic viscerocranium morphogenesis decreased occurrence, abnormal TU + MO2-bmp5 standard conditions Fig. 3 from Shih et al., 2017
whole organism foxd3 expression decreased amount, abnormal TU + MO2-bmp5 standard conditions Fig. 3 from Shih et al., 2017
melanocyte mitfa expression decreased amount, abnormal TU + MO2-bmp5 standard conditions Fig. 3 from Shih et al., 2017
whole organism sox10 expression decreased amount, abnormal TU + MO2-bmp5 standard conditions Fig. 2Fig. 4Fig. 5 from Shih et al., 2017
whole organism neurod1 expression decreased amount, abnormal TU + MO2-bmp5 standard conditions Fig. 3 from Shih et al., 2017
whole organism msx1b expression decreased amount, abnormal TU + MO2-bmp5 standard conditions Fig. 4 from Shih et al., 2017
perineuronal satellite cell mbpa expression decreased amount, abnormal TU + MO2-bmp5 standard conditions Fig. 3 from Shih et al., 2017
neural crest cell population proliferation decreased occurrence, abnormal TU + MO2-bmp5 standard conditions Fig. 2Fig. 5 from Shih et al., 2017
neural crest sox10 expression decreased amount, abnormal TU + MO2-bmp5 standard conditions Fig. 2Fig. 4Fig. 5Fig. 6 from Shih et al., 2017
whole organism mitfa expression decreased amount, abnormal TU + MO2-bmp5 standard conditions Fig. 3 from Shih et al., 2017
whole organism dlx2a expression decreased amount, abnormal TU + MO2-bmp5 standard conditions Fig. 2Fig. 3Fig. 4Fig. 5 from Shih et al., 2017
neural crest msx1b expression decreased amount, abnormal TU + MO2-bmp5 standard conditions Fig. 4 from Shih et al., 2017
neural crest apoptotic process increased occurrence, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
neural crest dlx2a expression decreased amount, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
neural crest cell development decreased occurrence, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
whole organism sox10 expression decreased amount, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
neural crest cell population proliferation decreased occurrence, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
neural crest sox10 expression decreased amount, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
whole organism dlx2a expression decreased amount, abnormal TU + MO2-bmp5 + MO4-tp53 standard conditions Fig. 2 from Shih et al., 2017
Genome Resources:
CITATIONS (1)