Morpholino

MO1-zdhhc16a

ID
ZDB-MRPHLNO-170508-1
Name
MO1-zdhhc16a
Previous Names
None
Target
Sequence
5' - GCATGTTCAGCCCCTTCCCTCGATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-zdhhc16a
Expressed Gene Anatomy Figures
dlx2a Fig. 3 from Shi et al., 2016
egr2b Fig. 3 from Shi et al., 2016
emx2 Fig. 3 from Shi et al., 2016
etv4 Fig. 6 from Shi et al., 2016
etv5b Fig. 6 from Shi et al., 2016
fgf1a Fig. 6 from Shi et al., 2016
fgf2 Fig. 6 from Shi et al., 2016
fgfr1a Fig. 6 from Shi et al., 2016
foxg1a Fig. 3 from Shi et al., 2016
mcm5 Fig. 4 from Shi et al., 2016
otx2b Fig. 3 from Shi et al., 2016
pax2a Fig. 3 from Shi et al., 2016
pcna Fig. 4 from Shi et al., 2016
rx3 Fig. 3 from Shi et al., 2016
sox2 Fig. 4 from Shi et al., 2016
sox3 Fig. 3 from Shi et al., 2016
Phenotype
Phenotype resulting from MO1-zdhhc16a
Phenotype Fish Figures
anterior neural plate aplastic/hypoplastic, abnormal AB + MO1-zdhhc16a Fig. 2 from Shi et al., 2016
anterior neural plate pcna expression decreased amount, abnormal AB + MO1-zdhhc16a Fig. 4 from Shi et al., 2016
anterior neural plate rx3 expression decreased amount, abnormal AB + MO1-zdhhc16a Fig. 3 from Shi et al., 2016
anterior neural plate sox2 expression decreased amount, abnormal AB + MO1-zdhhc16a Fig. 4 from Shi et al., 2016
anterior neural plate rx3 expression decreased distribution, abnormal AB + MO1-zdhhc16a Fig. 3 from Shi et al., 2016
anterior neural plate pcna expression decreased distribution, abnormal AB + MO1-zdhhc16a Fig. 4 from Shi et al., 2016
anterior neural plate sox2 expression decreased distribution, abnormal AB + MO1-zdhhc16a Fig. 4 from Shi et al., 2016
ERK1 and ERK2 cascade decreased process quality, abnormal AB + MO1-zdhhc16a Fig. 6 from Shi et al., 2016
fibroblast growth factor receptor signaling pathway decreased process quality, abnormal AB + MO1-zdhhc16a Fig. 6 from Shi et al., 2016
head decreased size, abnormal AB + MO1-zdhhc16a Fig. 2 from Shi et al., 2016
presumptive neural plate sox3 expression decreased amount, abnormal AB + MO1-zdhhc16a Fig. 3 from Shi et al., 2016
presumptive neural plate sox3 expression decreased distribution, abnormal AB + MO1-zdhhc16a Fig. 3 from Shi et al., 2016
presumptive telencephalon aplastic/hypoplastic, abnormal AB + MO1-zdhhc16a Fig. 2 from Shi et al., 2016
presumptive telencephalon sox2 expression decreased amount, abnormal AB + MO1-zdhhc16a Fig. 4 from Shi et al., 2016
presumptive telencephalon sox2 expression decreased distribution, abnormal AB + MO1-zdhhc16a Fig. 4 from Shi et al., 2016
telencephalon aplastic/hypoplastic, abnormal AB + MO1-zdhhc16a Fig. 2 from Shi et al., 2016
telencephalon dlx2a expression decreased amount, abnormal AB + MO1-zdhhc16a Fig. 3 from Shi et al., 2016
telencephalon pcna expression decreased amount, abnormal AB + MO1-zdhhc16a Fig. 4 from Shi et al., 2016
telencephalon foxg1a expression decreased amount, abnormal AB + MO1-zdhhc16a Fig. 3 from Shi et al., 2016
telencephalon sox2 expression decreased amount, abnormal AB + MO1-zdhhc16a Fig. 4 from Shi et al., 2016
telencephalon sox2 expression decreased distribution, abnormal AB + MO1-zdhhc16a Fig. 4 from Shi et al., 2016
telencephalon dlx2a expression decreased distribution, abnormal AB + MO1-zdhhc16a Fig. 3 from Shi et al., 2016
telencephalon pcna expression decreased distribution, abnormal AB + MO1-zdhhc16a Fig. 4 from Shi et al., 2016
telencephalon foxg1a expression decreased distribution, abnormal AB + MO1-zdhhc16a Fig. 3 from Shi et al., 2016
telencephalon hypoplastic, abnormal AB + MO1-zdhhc16a Fig. 2 from Shi et al., 2016
telencephalon cell population proliferation decreased occurrence, abnormal AB + MO1-zdhhc16a Fig. 4 from Shi et al., 2016
telencephalon commitment of multipotent stem cells to neuronal lineage in forebrain decreased occurrence, abnormal AB + MO1-zdhhc16a Fig. 4 from Shi et al., 2016
telencephalon neuron decreased amount, abnormal AB + MO1-zdhhc16a Fig. 3 from Shi et al., 2016
ventral telencephalon emx2 expression decreased amount, abnormal AB + MO1-zdhhc16a Fig. 3 from Shi et al., 2016
ventral telencephalon emx2 expression decreased distribution, abnormal AB + MO1-zdhhc16a Fig. 3 from Shi et al., 2016
whole organism etv5b expression decreased amount, abnormal AB + MO1-zdhhc16a Fig. 6 from Shi et al., 2016
whole organism etv4 expression decreased amount, abnormal AB + MO1-zdhhc16a Fig. 6 from Shi et al., 2016
whole organism pcna expression decreased amount, abnormal AB + MO1-zdhhc16a Fig. 4 from Shi et al., 2016
whole organism mcm5 expression decreased amount, abnormal AB + MO1-zdhhc16a Fig. 4 from Shi et al., 2016
Phenotype of all Fish created by or utilizing MO1-zdhhc16a
Phenotype Fish Conditions Figures
anterior neural plate sox2 expression decreased distribution, abnormal AB + MO1-zdhhc16a standard conditions Fig. 4 from Shi et al., 2016
telencephalon foxg1a expression decreased amount, abnormal AB + MO1-zdhhc16a standard conditions Fig. 3 from Shi et al., 2016
anterior neural plate pcna expression decreased distribution, abnormal AB + MO1-zdhhc16a standard conditions Fig. 4 from Shi et al., 2016
telencephalon commitment of multipotent stem cells to neuronal lineage in forebrain decreased occurrence, abnormal AB + MO1-zdhhc16a standard conditions Fig. 4 from Shi et al., 2016
presumptive neural plate sox3 expression decreased distribution, abnormal AB + MO1-zdhhc16a standard conditions Fig. 3 from Shi et al., 2016
neuronal stem cell cell population proliferation decreased occurrence, abnormal AB + MO1-zdhhc16a primary cell culture: neuronal stem cell Fig. 5 from Shi et al., 2016
whole organism etv4 expression decreased amount, abnormal AB + MO1-zdhhc16a standard conditions Fig. 6 from Shi et al., 2016
telencephalon dlx2a expression decreased distribution, abnormal AB + MO1-zdhhc16a standard conditions Fig. 3 from Shi et al., 2016
anterior neural plate rx3 expression decreased distribution, abnormal AB + MO1-zdhhc16a standard conditions Fig. 3 from Shi et al., 2016
telencephalon foxg1a expression decreased distribution, abnormal AB + MO1-zdhhc16a standard conditions Fig. 3 from Shi et al., 2016
anterior neural plate pcna expression decreased amount, abnormal AB + MO1-zdhhc16a standard conditions Fig. 4 from Shi et al., 2016
telencephalon hypoplastic, abnormal AB + MO1-zdhhc16a standard conditions Fig. 2 from Shi et al., 2016
anterior neural plate sox2 expression decreased amount, abnormal AB + MO1-zdhhc16a standard conditions Fig. 4 from Shi et al., 2016
telencephalon cell population proliferation decreased occurrence, abnormal AB + MO1-zdhhc16a standard conditions Fig. 4 from Shi et al., 2016
telencephalon pcna expression decreased distribution, abnormal AB + MO1-zdhhc16a standard conditions Fig. 4 from Shi et al., 2016
head decreased size, abnormal AB + MO1-zdhhc16a standard conditions Fig. 2 from Shi et al., 2016
presumptive telencephalon sox2 expression decreased amount, abnormal AB + MO1-zdhhc16a standard conditions Fig. 4 from Shi et al., 2016
telencephalon neuron decreased amount, abnormal AB + MO1-zdhhc16a standard conditions Fig. 3 from Shi et al., 2016
whole organism mcm5 expression decreased amount, abnormal AB + MO1-zdhhc16a standard conditions Fig. 4 from Shi et al., 2016
anterior neural plate rx3 expression decreased amount, abnormal AB + MO1-zdhhc16a standard conditions Fig. 3 from Shi et al., 2016
telencephalon pcna expression decreased amount, abnormal AB + MO1-zdhhc16a standard conditions Fig. 4 from Shi et al., 2016
fibroblast growth factor receptor signaling pathway decreased process quality, abnormal AB + MO1-zdhhc16a standard conditions Fig. 6 from Shi et al., 2016
presumptive neural plate sox3 expression decreased amount, abnormal AB + MO1-zdhhc16a standard conditions Fig. 3 from Shi et al., 2016
whole organism pcna expression decreased amount, abnormal AB + MO1-zdhhc16a standard conditions Fig. 4 from Shi et al., 2016
ERK1 and ERK2 cascade decreased process quality, abnormal AB + MO1-zdhhc16a standard conditions Fig. 6 from Shi et al., 2016
telencephalon aplastic/hypoplastic, abnormal AB + MO1-zdhhc16a standard conditions Fig. 2 from Shi et al., 2016
telencephalon dlx2a expression decreased amount, abnormal AB + MO1-zdhhc16a standard conditions Fig. 3 from Shi et al., 2016
telencephalon sox2 expression decreased amount, abnormal AB + MO1-zdhhc16a standard conditions Fig. 4 from Shi et al., 2016
telencephalon sox2 expression decreased distribution, abnormal AB + MO1-zdhhc16a standard conditions Fig. 4 from Shi et al., 2016
presumptive telencephalon sox2 expression decreased distribution, abnormal AB + MO1-zdhhc16a standard conditions Fig. 4 from Shi et al., 2016
ventral telencephalon emx2 expression decreased amount, abnormal AB + MO1-zdhhc16a standard conditions Fig. 3 from Shi et al., 2016
presumptive telencephalon aplastic/hypoplastic, abnormal AB + MO1-zdhhc16a standard conditions Fig. 2 from Shi et al., 2016
whole organism etv5b expression decreased amount, abnormal AB + MO1-zdhhc16a standard conditions Fig. 6 from Shi et al., 2016
ventral telencephalon emx2 expression decreased distribution, abnormal AB + MO1-zdhhc16a standard conditions Fig. 3 from Shi et al., 2016
anterior neural plate aplastic/hypoplastic, abnormal AB + MO1-zdhhc16a standard conditions Fig. 2 from Shi et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.