Morpholino

MO1-smchd1

ID
ZDB-MRPHLNO-170322-5
Name
MO1-smchd1
Previous Names
  • exon 3 splice donor e3i3 (1)
Target
Sequence
5' - AGGTGTGATTTCAGACTTACGCAAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-smchd1
No data available
Phenotype
Phenotype resulting from MO1-smchd1
Phenotype Fish Figures
caudal hematopoietic tissue tal1 expression decreased amount, abnormal TU + MO1-smchd1 Fig. S5 with image from Xue et al., 2019
caudal hematopoietic tissue myb expression decreased amount, abnormal TU + MO1-smchd1 Fig. S5 with image from Xue et al., 2019
caudal hematopoietic tissue GFP expression decreased amount, abnormal ioz1Tg; pku6Tg + MO1-smchd1 Fig. 3 with image from Xue et al., 2019
caudal hematopoietic tissue gata1a expression decreased amount, abnormal TU + MO1-smchd1 Fig. S5 with image from Xue et al., 2019
caudal hematopoietic tissue GFP expression decreased distribution, abnormal ioz1Tg; pku6Tg + MO1-smchd1 Fig. 3 with image from Xue et al., 2019
caudal hematopoietic tissue hematopoietic cell decreased amount, abnormal ioz1Tg; pku6Tg + MO1-smchd1 Fig. 3 with image from Xue et al., 2019
ceratohyal cartilage malformed, abnormal zf195Tg + MO1-smchd1 (AB) Fig. 5 from Shaw et al., 2017
embryonic cranial skeleton morphogenesis decreased process quality, abnormal zf195Tg + MO1-smchd1 (AB) Fig. 5 from Shaw et al., 2017
embryonic viscerocranium morphogenesis decreased process quality, abnormal zf195Tg + MO1-smchd1 (AB) Fig. 5 from Shaw et al., 2017
ethmoid cartilage decreased width, abnormal zf195Tg + MO1-smchd1 (AB) Fig. 5 from Shaw et al., 2017
eye decreased size, abnormal zf195Tg + MO1-smchd1 (AB) Fig. 5 from Shaw et al., 2017
hematopoietic multipotent progenitor cell cell population proliferation decreased occurrence, abnormal cz3331Tg + MO1-smchd1 Fig. S5 with image from Xue et al., 2019
pharyngeal arch 3-7 skeleton has fewer parts of type ceratobranchial cartilage, abnormal zf195Tg + MO1-smchd1 (AB) Fig. 5 from Shaw et al., 2017
thymus GFP expression decreased amount, abnormal ioz1Tg; pku6Tg + MO1-smchd1 Fig. 3 with image from Xue et al., 2019
thymus rag1 expression decreased amount, abnormal TU + MO1-smchd1 Fig. S5 with image from Xue et al., 2019
thymus GFP expression decreased distribution, abnormal ioz1Tg; pku6Tg + MO1-smchd1 Fig. 3 with image from Xue et al., 2019
thymus hematopoietic cell decreased amount, abnormal ioz1Tg; pku6Tg + MO1-smchd1 Fig. 3 with image from Xue et al., 2019
Phenotype of all Fish created by or utilizing MO1-smchd1
Phenotype Fish Conditions Figures
caudal hematopoietic tissue tal1 expression decreased amount, abnormal TU + MO1-smchd1 control Fig. S5 with image from Xue et al., 2019
caudal hematopoietic tissue gata1a expression decreased amount, abnormal TU + MO1-smchd1 control Fig. S5 with image from Xue et al., 2019
thymus rag1 expression decreased amount, abnormal TU + MO1-smchd1 control Fig. S5 with image from Xue et al., 2019
caudal hematopoietic tissue myb expression decreased amount, abnormal TU + MO1-smchd1 control Fig. S5 with image from Xue et al., 2019
hematopoietic multipotent progenitor cell cell population proliferation decreased occurrence, abnormal cz3331Tg + MO1-smchd1 control Fig. S5 with image from Xue et al., 2019
eye decreased size, abnormal zf195Tg + MO1-smchd1 (AB) standard conditions Fig. 5 from Shaw et al., 2017
embryonic cranial skeleton morphogenesis decreased process quality, abnormal zf195Tg + MO1-smchd1 (AB) standard conditions Fig. 5 from Shaw et al., 2017
embryonic viscerocranium morphogenesis decreased process quality, abnormal zf195Tg + MO1-smchd1 (AB) standard conditions Fig. 5 from Shaw et al., 2017
ceratohyal cartilage malformed, abnormal zf195Tg + MO1-smchd1 (AB) standard conditions Fig. 5 from Shaw et al., 2017
ethmoid cartilage decreased width, abnormal zf195Tg + MO1-smchd1 (AB) standard conditions Fig. 5 from Shaw et al., 2017
pharyngeal arch 3-7 skeleton has fewer parts of type ceratobranchial cartilage, abnormal zf195Tg + MO1-smchd1 (AB) standard conditions Fig. 5 from Shaw et al., 2017
caudal hematopoietic tissue hematopoietic cell decreased amount, abnormal ioz1Tg; pku6Tg + MO1-smchd1 control Fig. 3 with image from Xue et al., 2019
thymus GFP expression decreased distribution, abnormal ioz1Tg; pku6Tg + MO1-smchd1 control Fig. 3 with image from Xue et al., 2019
caudal hematopoietic tissue GFP expression decreased distribution, abnormal ioz1Tg; pku6Tg + MO1-smchd1 control Fig. 3 with image from Xue et al., 2019
caudal hematopoietic tissue GFP expression decreased amount, abnormal ioz1Tg; pku6Tg + MO1-smchd1 control Fig. 3 with image from Xue et al., 2019
thymus GFP expression decreased amount, abnormal ioz1Tg; pku6Tg + MO1-smchd1 control Fig. 3 with image from Xue et al., 2019
thymus hematopoietic cell decreased amount, abnormal ioz1Tg; pku6Tg + MO1-smchd1 control Fig. 3 with image from Xue et al., 2019
Citations