Morpholino

MO3-atoh8

ID

ZDB-MRPHLNO-170314-2

Name

MO3-atoh8

Previous Names

None

Target

atoh8 (1)

Sequence

5' - GTTTAGATGTGGGTTCTTCATTTCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-atoh8

No data available

Phenotype

Phenotype resulting from MO3-atoh8

Phenotype	Fish	Figures
heart looping disrupted, abnormal	p150Tg + MO3-atoh8	Fig. 1 from Rawnsley et al., 2013
heart tube shape, abnormal	p150Tg + MO3-atoh8	Fig. 1 from Rawnsley et al., 2013
pericardium edematous, abnormal	atoh8^{sa1465/sa1465} + MO3-atoh8	Fig. 2 from Place et al., 2017 Fig. 1 from Rawnsley et al., 2013
swim bladder uninflated, abnormal	TL + MO3-atoh8	Fig. 2 from Rawnsley et al., 2013
swim bladder inflation disrupted, abnormal	TL + MO3-atoh8	Fig. 2 from Rawnsley et al., 2013

Phenotype of all Fish created by or utilizing MO3-atoh8

Phenotype	Fish	Conditions	Figures
pericardium edematous, abnormal	atoh8^{sa1465/sa1465} + MO3-atoh8	standard conditions	Fig. 2 from Place et al., 2017
swim bladder inflation disrupted, abnormal	TL + MO3-atoh8	standard conditions	Fig. 2 from Rawnsley et al., 2013
pericardium edematous, abnormal	TL + MO3-atoh8	standard conditions	Fig. 1 from Rawnsley et al., 2013
swim bladder uninflated, abnormal	TL + MO3-atoh8	standard conditions	Fig. 2 from Rawnsley et al., 2013
heart tube shape, abnormal	TL + MO3-atoh8 + MO4-atoh8 + MO5-atoh8	standard conditions	Fig. 1 from Rawnsley et al., 2013
heart looping disrupted, abnormal	TL + MO3-atoh8 + MO4-atoh8 + MO5-atoh8	standard conditions	Fig. 1 from Rawnsley et al., 2013
pericardium edematous, abnormal	WT + MO3-atoh8	standard conditions	Fig. 2 from Place et al., 2017
heart tube shape, abnormal	p150Tg + MO3-atoh8	standard conditions	Fig. 1 from Rawnsley et al., 2013
heart looping disrupted, abnormal	p150Tg + MO3-atoh8	standard conditions	Fig. 1 from Rawnsley et al., 2013
swim bladder uninflated, abnormal	TL + MO1-gata4 + MO3-atoh8	standard conditions	Fig. 3 from Rawnsley et al., 2013
heart tube shape, abnormal	TL + MO1-gata4 + MO3-atoh8	standard conditions	Fig. 3 from Rawnsley et al., 2013
heart looping disrupted, abnormal	TL + MO1-gata4 + MO3-atoh8	standard conditions	Fig. 3 from Rawnsley et al., 2013
swim bladder inflation disrupted, abnormal	TL + MO1-gata4 + MO3-atoh8	standard conditions	Fig. 3 from Rawnsley et al., 2013
heart looping disrupted, abnormal	TL + MO1-tbx5a + MO3-atoh8	standard conditions	Fig. 3 from Rawnsley et al., 2013
heart tube shape, abnormal	TL + MO1-tbx5a + MO3-atoh8	standard conditions	Fig. 3 from Rawnsley et al., 2013
heart looping disrupted, abnormal	TL + MO3-atoh8 + MO3-zfpm1	standard conditions	Fig. 3 from Rawnsley et al., 2013
heart tube shape, abnormal	TL + MO3-atoh8 + MO3-zfpm1	standard conditions	Fig. 3 from Rawnsley et al., 2013
heart looping disrupted, abnormal	TL + MO3-atoh8 + MO5-mef2ca	standard conditions	Fig. 3 from Rawnsley et al., 2013
heart tube shape, abnormal	TL + MO3-atoh8 + MO5-mef2ca	standard conditions	Fig. 3 from Rawnsley et al., 2013
heart looping disrupted, abnormal	TL + MO1-gata4 + MO3-atoh8 + MO3-zfpm1	standard conditions	Fig. 3 from Rawnsley et al., 2013
heart tube shape, abnormal	TL + MO1-gata4 + MO3-atoh8 + MO3-zfpm1	standard conditions	Fig. 3 from Rawnsley et al., 2013

Citations