Morpholino

MO3-efnb1

ID
ZDB-MRPHLNO-161220-3
Name
MO3-efnb1
Previous Names
  • MOdon-ephrinb1 (1)
Target
Sequence
5' - TGCACTTACTTGGGATTTTGCGAAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-efnb1
No data available
Phenotype
Phenotype resulting from MO3-efnb1
No data available
Phenotype of all Fish created by or utilizing MO3-efnb1
Phenotype Fish Conditions Figures
mesoderm apical junction complex ab1-tjp1 labeling mislocalised, abnormal WT + MO2-efnb1 + MO3-efnb1 standard conditions Fig. 5 with image from Cayuso et al., 2016
embryonic digestive tract development decreased process quality, abnormal WT + MO2-efnb1 + MO3-efnb1 standard conditions Fig. 5 with image from Cayuso et al., 2016
hepatoblast has fewer parts of type hepatoblast filopodium, abnormal WT + MO2-efnb1 + MO3-efnb1 standard conditions Fig. 6 with image from Cayuso et al., 2016
hepatoblast filopodium decreased length, abnormal WT + MO2-efnb1 + MO3-efnb1 standard conditions Fig. 6 with image from Cayuso et al., 2016
lateral plate mesoderm establishment of epithelial cell apical/basal polarity decreased process quality, abnormal WT + MO2-efnb1 + MO3-efnb1 standard conditions Fig. 5 with image from Cayuso et al., 2016
intestinal bulb primordium decreased curvature, abnormal WT + MO2-efnb1 + MO3-efnb1 standard conditions Fig. 5 with image from Cayuso et al., 2016
hepatoblast regulation of filopodium assembly process quality, abnormal WT + MO2-efnb1 + MO3-efnb1 standard conditions Fig. 6 with image from Cayuso et al., 2016
liver primordium malformed, abnormal zf106Tg + MO2-efnb1 + MO3-efnb1 standard conditions Fig. 4 with image from Cayuso et al., 2016
hepatoblast shape, abnormal zf106Tg + MO2-efnb1 + MO3-efnb1 standard conditions Fig. 4 with image from Cayuso et al., 2016
hepatoblast mislocalised posteriorly, abnormal zf106Tg + MO2-efnb1 + MO3-efnb1 standard conditions Fig. 4 with image from Cayuso et al., 2016
hepatocyte cell migration decreased occurrence, abnormal zf106Tg + MO2-efnb1 + MO3-efnb1 standard conditions Fig. 4 with image from Cayuso et al., 2016
hepatoblast anterior orientation, abnormal zf106Tg + MO2-efnb1 + MO3-efnb1 standard conditions Fig. 4 with image from Cayuso et al., 2016
embryonic digestive tract development decreased process quality, abnormal zf106Tg + MO2-efnb1 + MO3-efnb1 standard conditions Fig. 4 with image from Cayuso et al., 2016
intestinal bulb primordium decreased curvature, abnormal zf106Tg + MO2-efnb1 + MO3-efnb1 standard conditions Fig. 4 with image from Cayuso et al., 2016
embryonic liver development process quality, abnormal zf106Tg + MO2-efnb1 + MO3-efnb1 standard conditions Fig. 4 with image from Cayuso et al., 2016
hepatoblast mislocalised medially, abnormal zf106Tg + MO2-efnb1 + MO3-efnb1 standard conditions Fig. 4 with image from Cayuso et al., 2016
Citations