Morpholino

MO2-bcl11aa

ID

ZDB-MRPHLNO-161206-6

Name

MO2-bcl11aa

Previous Names

Target

Sequence

5' - TGTCTTTACTTACGCGAAAAATCCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-bcl11aa

No data available

Phenotype

Phenotype resulting from MO2-bcl11aa

Phenotype	Fish	Figures
brain decreased volume, abnormal	AB + MO2-bcl11aa + MO4-tp53	Fig. 8 from Bagheri et al., 2016
brain development disrupted, abnormal	AB + MO2-bcl11aa + MO4-tp53	Fig. 8 from Bagheri et al., 2016
eye decreased size, abnormal	AB + MO2-bcl11aa + MO4-tp53	Fig. 7 from Bagheri et al., 2016
fin decreased size, abnormal	AB + MO2-bcl11aa + MO4-tp53	Fig. 7 from Bagheri et al., 2016
head morphology, abnormal	AB + MO2-bcl11aa	Fig. 6 from Bagheri et al., 2016
otic vesicle decreased size, abnormal	AB + MO2-bcl11aa + MO4-tp53	Fig. 7 from Bagheri et al., 2016
post-vent region decreased size, abnormal	AB + MO2-bcl11aa + MO4-tp53	Fig. 7 from Bagheri et al., 2016
trunk morphology, abnormal	AB + MO2-bcl11aa + MO4-tp53	Fig. 6 from Bagheri et al., 2016

Phenotype of all Fish created by or utilizing MO2-bcl11aa

Phenotype	Fish	Conditions	Figures
head morphology, abnormal	AB + MO2-bcl11aa	standard conditions	Fig. 6 from Bagheri et al., 2016
trunk morphology, abnormal	AB + MO2-bcl11aa	standard conditions	Fig. 6 from Bagheri et al., 2016
brain decreased volume, abnormal	AB + MO2-bcl11aa + MO4-tp53	standard conditions	Fig. 8 from Bagheri et al., 2016
eye decreased size, abnormal	AB + MO2-bcl11aa + MO4-tp53	standard conditions	Fig. 7 from Bagheri et al., 2016
head morphology, abnormal	AB + MO2-bcl11aa + MO4-tp53	standard conditions	Fig. 6 from Bagheri et al., 2016
otic vesicle decreased size, abnormal	AB + MO2-bcl11aa + MO4-tp53	standard conditions	Fig. 7 from Bagheri et al., 2016
trunk morphology, abnormal	AB + MO2-bcl11aa + MO4-tp53	standard conditions	Fig. 6 from Bagheri et al., 2016
fin decreased size, abnormal	AB + MO2-bcl11aa + MO4-tp53	standard conditions	Fig. 7 from Bagheri et al., 2016
post-vent region decreased size, abnormal	AB + MO2-bcl11aa + MO4-tp53	standard conditions	Fig. 7 from Bagheri et al., 2016
brain development disrupted, abnormal	AB + MO2-bcl11aa + MO4-tp53	standard conditions	Fig. 8 from Bagheri et al., 2016

Citations