Morpholino

MO3-nolc1

ID
ZDB-MRPHLNO-161205-3
Name
MO3-nolc1
Previous Names
None
Target
Sequence
5' - TAGGAACCGTGCTGTCCTCCGCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-nolc1
No data available
Phenotype
Phenotype resulting from MO3-nolc1
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO3-nolc1 Fig. 2 with image from de Peralta et al., 2016
apoptotic process process quality, ameliorated WT + MO3-nolc1 + MO4-tp53 Fig. 2 with image from de Peralta et al., 2016
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal WT + MO3-nolc1 Fig. 1Fig. 3 from Rosas et al., 2019
cranial cartilage morphology, abnormal WT + MO3-nolc1 Fig. 1 with imageFig. 2 with image from de Peralta et al., 2016
cranial cartilage morphology, ameliorated WT + MO3-nolc1 + MO4-tp53 Fig. 2 with image from de Peralta et al., 2016
cranium decreased length, abnormal WT + MO3-nolc1 Fig. 1Fig. 3 from Rosas et al., 2019
embryonic cranial skeleton morphogenesis disrupted, abnormal WT + MO3-nolc1 Fig. 1 with imageFig. 2 with image from de Peralta et al., 2016
embryonic cranial skeleton morphogenesis process quality, ameliorated WT + MO3-nolc1 + MO4-tp53 Fig. 2 with image from de Peralta et al., 2016
head apoptotic, abnormal WT + MO3-nolc1 Fig. 2 with image from de Peralta et al., 2016
head apoptotic process increased frequency, abnormal WT + MO3-nolc1 Fig. 5 from Rosas et al., 2019
hyosymplectic cartilage decreased length, abnormal WT + MO3-nolc1 Fig. 1Fig. 3 from Rosas et al., 2019
Meckel's cartilage increased angle to Meckel's cartilage, abnormal WT + MO3-nolc1 Fig. 1Fig. 3 from Rosas et al., 2019
palatoquadrate cartilage decreased length, abnormal WT + MO3-nolc1 Fig. 1Fig. 3 from Rosas et al., 2019
pharyngeal arch cartilage morphology, abnormal WT + MO3-nolc1 Fig. 2 from Rosas et al., 2019
ventral mandibular arch decreased width, abnormal WT + MO3-nolc1 Fig. 3 from Rosas et al., 2019
whole organism tp53inp1 expression amount, ameliorated WT + MO3-nolc1 + MO4-tp53 Fig. 2 with image from de Peralta et al., 2016
whole organism pmaip1 expression amount, ameliorated WT + MO3-nolc1 + MO4-tp53 Fig. 2 with image from de Peralta et al., 2016
whole organism cnbpa expression decreased amount, abnormal WT + MO3-nolc1 Fig. 1Fig. 4 from Rosas et al., 2019
Fig. 4 with image from de Peralta et al., 2016
whole organism nolc1 expression decreased amount, abnormal WT + MO3-nolc1 Fig. 1 from Rosas et al., 2019
whole organism pmaip1 expression increased amount, abnormal WT + MO3-nolc1 Fig. 2 with image from de Peralta et al., 2016
whole organism ccng1 expression increased amount, abnormal WT + MO3-nolc1 Fig. 2 with image from de Peralta et al., 2016
whole organism tp53inp1 expression increased amount, abnormal WT + MO3-nolc1 Fig. 2 with image from de Peralta et al., 2016
whole organism reactive oxygen species increased amount, abnormal WT + MO3-nolc1 Fig. 5 from Rosas et al., 2019
Phenotype of all Fish created by or utilizing MO3-nolc1
Phenotype Fish Conditions Figures
cranial cartilage morphology, abnormal WT + MO3-nolc1 standard conditions Fig. 1 with imageFig. 2 with image from de Peralta et al., 2016
palatoquadrate cartilage decreased length, ameliorated WT + MO3-nolc1 chemical treatment: bortezomib Fig. 3 from Rosas et al., 2019
whole organism ccng1 expression increased amount, abnormal WT + MO3-nolc1 standard conditions Fig. 2 with image from de Peralta et al., 2016
whole organism nolc1 expression decreased amount, abnormal WT + MO3-nolc1 standard conditions Fig. 1 from Rosas et al., 2019
head apoptotic process increased frequency, abnormal WT + MO3-nolc1 control Fig. 5 from Rosas et al., 2019
pharyngeal arch cartilage morphology, abnormal WT + MO3-nolc1 control Fig. 2 from Rosas et al., 2019
whole organism cnbpa expression increased amount, abnormal WT + MO3-nolc1 chemical treatment: bortezomib Fig. 4 from Rosas et al., 2019
apoptotic process increased occurrence, abnormal WT + MO3-nolc1 standard conditions Fig. 2 with image from de Peralta et al., 2016
hyosymplectic cartilage decreased length, ameliorated WT + MO3-nolc1 chemical treatment: bortezomib Fig. 3 from Rosas et al., 2019
hyosymplectic cartilage decreased length, abnormal WT + MO3-nolc1 standard conditions Fig. 1Fig. 3 from Rosas et al., 2019
cranium decreased length, abnormal WT + MO3-nolc1 standard conditions Fig. 1Fig. 3 from Rosas et al., 2019
Meckel's cartilage increased angle to Meckel's cartilage, ameliorated WT + MO3-nolc1 chemical treatment by environment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 3 from Rosas et al., 2019
hyosymplectic cartilage decreased length, ameliorated WT + MO3-nolc1 chemical treatment by environment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 3 from Rosas et al., 2019
whole organism cnbpa expression increased amount, abnormal WT + MO3-nolc1 chemical treatment by environment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 4 from Rosas et al., 2019
head apoptotic process increased frequency, ameliorated WT + MO3-nolc1 chemical treatment: bortezomib Fig. 5 from Rosas et al., 2019
palatoquadrate cartilage decreased length, ameliorated WT + MO3-nolc1 chemical treatment by environment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 3 from Rosas et al., 2019
pharyngeal arch cartilage morphology, ameliorated WT + MO3-nolc1 chemical treatment: bortezomib Fig. 2 from Rosas et al., 2019
ventral mandibular arch decreased width, ameliorated WT + MO3-nolc1 chemical treatment by environment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 3 from Rosas et al., 2019
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal WT + MO3-nolc1 chemical treatment by environment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 3 from Rosas et al., 2019
pharyngeal arch cartilage morphology, ameliorated WT + MO3-nolc1 chemical treatment by environment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 2 from Rosas et al., 2019
Meckel's cartilage increased angle to Meckel's cartilage, abnormal WT + MO3-nolc1 standard conditions Fig. 1Fig. 3 from Rosas et al., 2019
cranium decreased length, ameliorated WT + MO3-nolc1 chemical treatment by environment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 3 from Rosas et al., 2019
ventral mandibular arch decreased width, ameliorated WT + MO3-nolc1 chemical treatment: bortezomib Fig. 3 from Rosas et al., 2019
whole organism reactive oxygen species increased amount, ameliorated WT + MO3-nolc1 chemical treatment: bortezomib Fig. 5 from Rosas et al., 2019
whole organism reactive oxygen species increased amount, ameliorated WT + MO3-nolc1 chemical treatment by environment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 5 from Rosas et al., 2019
head apoptotic, abnormal WT + MO3-nolc1 standard conditions Fig. 2 with image from de Peralta et al., 2016
whole organism cnbpa expression decreased amount, abnormal WT + MO3-nolc1 control Fig. 1Fig. 4 from Rosas et al., 2019
Fig. 4 with image from de Peralta et al., 2016
head apoptotic process increased frequency, ameliorated WT + MO3-nolc1 chemical treatment by environment: N-benzyloxycarbonyl-L-leucyl-L-leucyl-L-leucinal Fig. 5 from Rosas et al., 2019
embryonic cranial skeleton morphogenesis disrupted, abnormal WT + MO3-nolc1 standard conditions Fig. 1 with imageFig. 2 with image from de Peralta et al., 2016
whole organism pmaip1 expression increased amount, abnormal WT + MO3-nolc1 standard conditions Fig. 2 with image from de Peralta et al., 2016
whole organism reactive oxygen species increased amount, abnormal WT + MO3-nolc1 control Fig. 5 from Rosas et al., 2019
ceratohyal cartilage increased angle to ceratohyal cartilage, ameliorated WT + MO3-nolc1 chemical treatment: bortezomib Fig. 3 from Rosas et al., 2019
whole organism tp53inp1 expression increased amount, abnormal WT + MO3-nolc1 standard conditions Fig. 2 with image from de Peralta et al., 2016
palatoquadrate cartilage decreased length, abnormal WT + MO3-nolc1 standard conditions Fig. 1Fig. 3 from Rosas et al., 2019
ventral mandibular arch decreased width, abnormal WT + MO3-nolc1 control Fig. 3 from Rosas et al., 2019
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal WT + MO3-nolc1 standard conditions Fig. 1Fig. 3 from Rosas et al., 2019
Meckel's cartilage increased angle to Meckel's cartilage, ameliorated WT + MO3-nolc1 chemical treatment: bortezomib Fig. 3 from Rosas et al., 2019
whole organism ccng1 expression increased amount, abnormal WT + MO3-nolc1 + MO4-tp53 standard conditions Fig. 2 with image from de Peralta et al., 2016
embryonic cranial skeleton morphogenesis process quality, ameliorated WT + MO3-nolc1 + MO4-tp53 standard conditions Fig. 2 with image from de Peralta et al., 2016
cranial cartilage morphology, ameliorated WT + MO3-nolc1 + MO4-tp53 standard conditions Fig. 2 with image from de Peralta et al., 2016
apoptotic process process quality, ameliorated WT + MO3-nolc1 + MO4-tp53 standard conditions Fig. 2 with image from de Peralta et al., 2016
whole organism pmaip1 expression amount, ameliorated WT + MO3-nolc1 + MO4-tp53 standard conditions Fig. 2 with image from de Peralta et al., 2016
whole organism tp53inp1 expression amount, ameliorated WT + MO3-nolc1 + MO4-tp53 standard conditions Fig. 2 with image from de Peralta et al., 2016
Citations