Morpholino

MO1-kcnk1a

ID

ZDB-MRPHLNO-161107-1

Name

MO1-kcnk1a

Previous Names

I1E2-MO (1)

Target

kcnk1a (1)

Sequence

5' - TTGTCTCTGCTGGAAAAAGATAGGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-kcnk1a

No data available

Phenotype

Phenotype resulting from MO1-kcnk1a

Phenotype	Fish	Figures
atrium dilated, abnormal	twu34Tg + MO1-kcnk1a	Fig. 1, Fig. S1 from Christensen et al., 2016
heart elongated, abnormal	twu34Tg + MO1-kcnk1a	Fig. S1 from Christensen et al., 2016
heart increased size, abnormal	twu34Tg + MO1-kcnk1a	Fig. S1 from Christensen et al., 2016
heart contraction decreased rate, abnormal	twu34Tg + MO1-kcnk1a	Fig. 1, Fig. S1 from Christensen et al., 2016
pericardium edematous, abnormal	twu34Tg + MO1-kcnk1a	Fig. S1 from Christensen et al., 2016
post-vent region decreased length, abnormal	twu34Tg + MO1-kcnk1a	Fig. S1 from Christensen et al., 2016
post-vent region increased curvature, abnormal	twu34Tg + MO1-kcnk1a	Fig. S1 from Christensen et al., 2016

Phenotype of all Fish created by or utilizing MO1-kcnk1a

Phenotype	Fish	Conditions	Figures
atrium dilated, abnormal	twu34Tg + MO1-kcnk1a	standard conditions	Fig. 1, Fig. S1 from Christensen et al., 2016
heart increased size, abnormal	twu34Tg + MO1-kcnk1a	standard conditions	Fig. S1 from Christensen et al., 2016
heart elongated, abnormal	twu34Tg + MO1-kcnk1a	standard conditions	Fig. S1 from Christensen et al., 2016
heart contraction decreased rate, abnormal	twu34Tg + MO1-kcnk1a	standard conditions	Fig. 1, Fig. S1 from Christensen et al., 2016
post-vent region decreased length, abnormal	twu34Tg + MO1-kcnk1a	standard conditions	Fig. S1 from Christensen et al., 2016
post-vent region increased curvature, abnormal	twu34Tg + MO1-kcnk1a	standard conditions	Fig. S1 from Christensen et al., 2016
pericardium edematous, abnormal	twu34Tg + MO1-kcnk1a	standard conditions	Fig. S1 from Christensen et al., 2016
atrium dilated, abnormal	twu34Tg + MO1-kcnk1a + MO1-kcnk1b	standard conditions	Fig. 1, Fig. S1 from Christensen et al., 2016
heart increased size, abnormal	twu34Tg + MO1-kcnk1a + MO1-kcnk1b	standard conditions	Fig. S1 from Christensen et al., 2016
heart elongated, abnormal	twu34Tg + MO1-kcnk1a + MO1-kcnk1b	standard conditions	Fig. S1 from Christensen et al., 2016
cardiac ventricle dilated, abnormal	twu34Tg + MO1-kcnk1a + MO1-kcnk1b	standard conditions	Fig. 1, Fig. S1 from Christensen et al., 2016
post-vent region decreased length, abnormal	twu34Tg + MO1-kcnk1a + MO1-kcnk1b	standard conditions	Fig. S1 from Christensen et al., 2016
heart contraction decreased rate, abnormal	twu34Tg + MO1-kcnk1a + MO1-kcnk1b	standard conditions	Fig. 1, Fig. S1 from Christensen et al., 2016
pericardium edematous, abnormal	twu34Tg + MO1-kcnk1a + MO1-kcnk1b	standard conditions	Fig. S1 from Christensen et al., 2016
post-vent region increased curvature, abnormal	twu34Tg + MO1-kcnk1a + MO1-kcnk1b	standard conditions	Fig. S1 from Christensen et al., 2016

Citations