Morpholino

MO2-tgfbr3

ID
ZDB-MRPHLNO-160902-3
Name
MO2-tgfbr3
Previous Names
None
Target
Sequence
5' - GAATAACAGCGCTTACCTGCAGAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tgfbr3
No data available
Phenotype
Phenotype resulting from MO2-tgfbr3
Phenotype Fish Figures
caudal fin curved, abnormal y1Tg + MO2-tgfbr3 Fig. 4 with image from Kamaid et al., 2015
caudal vein plexus morphology, abnormal y1Tg + MO2-tgfbr3 Fig. 4 with imageFig. 6 with image from Kamaid et al., 2015
caudal vein plexus sprouting angiogenesis process quality, abnormal y1Tg + MO2-tgfbr3 Fig. 4 with imageFig. 6 with image from Kamaid et al., 2015
dorsal longitudinal anastomotic vessel aplastic, abnormal y1Tg + MO2-tgfbr3 Fig. 4 with imageFig. 5 with imageFig. 6 with imageFig. 7 with image from Kamaid et al., 2015
dorsal longitudinal anastomotic vessel blood vessel development decreased occurrence, abnormal y1Tg + MO2-tgfbr3 Fig. 4 with imageFig. 5 with imageFig. 6 with imageFig. 7 with image from Kamaid et al., 2015
intersegmental vessel decreased amount, abnormal y1Tg + MO2-tgfbr3 Fig. 4 with image from Kamaid et al., 2015
intersegmental vessel decreased size, abnormal y1Tg + MO2-tgfbr3 Fig. 4 with imageFig. 5 with imageFig. 6 with imageFig. 7 with image from Kamaid et al., 2015
intersegmental vessel sprouting angiogenesis process quality, abnormal y1Tg + MO2-tgfbr3 Fig. 4 with image from Kamaid et al., 2015
lymphangioblast cord spatial pattern, abnormal tgfbr3una202/una202; y1Tg + MO2-tgfbr3 Fig. 2 with image from Molina-Villa et al., 2021
notochord tgfbr3 expression absent, abnormal y1Tg + MO2-tgfbr3 Fig. 5 with image from Kamaid et al., 2015
somite circular, abnormal y1Tg + MO2-tgfbr3 Fig. 7 with image from Kamaid et al., 2015
somite shape, abnormal y1Tg + MO2-tgfbr3 Fig. 7 with image from Kamaid et al., 2015
somite actin filament disorganized, abnormal y1Tg + MO2-tgfbr3 Fig. 7 with image from Kamaid et al., 2015
somite ventral region tgfbr3 expression absent, abnormal y1Tg + MO2-tgfbr3 Fig. 5 with image from Kamaid et al., 2015
somite border blurry, abnormal y1Tg + MO2-tgfbr3 Fig. 7 with image from Kamaid et al., 2015
whole organism tgfbr3 expression absent, abnormal WT + MO2-tgfbr3 Fig. 5 with image from Kamaid et al., 2015
whole organism decreased size, abnormal y1Tg + MO2-tgfbr3 Fig. 4 with image from Kamaid et al., 2015
whole organism morphology, abnormal tgfbr3una202/una202; y1Tg + MO2-tgfbr3 Fig. 2 with image from Molina-Villa et al., 2021
whole organism shape, abnormal y1Tg + MO2-tgfbr3 Fig. 4 with image from Kamaid et al., 2015
Phenotype of all Fish created by or utilizing MO2-tgfbr3
Phenotype Fish Conditions Figures
whole organism tgfbr3 expression absent, abnormal WT + MO2-tgfbr3 standard conditions Fig. 5 with image from Kamaid et al., 2015
somite ventral region tgfbr3 expression absent, abnormal y1Tg + MO2-tgfbr3 control Fig. 5 with image from Kamaid et al., 2015
somite circular, abnormal y1Tg + MO2-tgfbr3 control Fig. 7 with image from Kamaid et al., 2015
intersegmental vessel sprouting angiogenesis process quality, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with image from Kamaid et al., 2015
dorsal longitudinal anastomotic vessel blood vessel development decreased occurrence, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with imageFig. 5 with imageFig. 6 with imageFig. 7 with image from Kamaid et al., 2015
whole organism morphology, abnormal y1Tg + MO2-tgfbr3 control Fig. 2 with image from Molina-Villa et al., 2021
intersegmental vessel decreased amount, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with image from Kamaid et al., 2015
notochord tgfbr3 expression absent, abnormal y1Tg + MO2-tgfbr3 control Fig. 5 with image from Kamaid et al., 2015
lymphangioblast cord spatial pattern, abnormal y1Tg + MO2-tgfbr3 control Fig. 2 with image from Molina-Villa et al., 2021
caudal vein plexus morphology, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with imageFig. 6 with image from Kamaid et al., 2015
somite actin filament disorganized, abnormal y1Tg + MO2-tgfbr3 control Fig. 7 with image from Kamaid et al., 2015
caudal vein plexus sprouting angiogenesis process quality, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with imageFig. 6 with image from Kamaid et al., 2015
caudal fin curved, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with image from Kamaid et al., 2015
whole organism shape, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with image from Kamaid et al., 2015
whole organism decreased size, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with image from Kamaid et al., 2015
intersegmental vessel decreased size, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with imageFig. 5 with imageFig. 6 with imageFig. 7 with image from Kamaid et al., 2015
somite shape, abnormal y1Tg + MO2-tgfbr3 control Fig. 7 with image from Kamaid et al., 2015
dorsal longitudinal anastomotic vessel aplastic, abnormal y1Tg + MO2-tgfbr3 control Fig. 4 with imageFig. 5 with imageFig. 6 with imageFig. 7 with image from Kamaid et al., 2015
somite border blurry, abnormal y1Tg + MO2-tgfbr3 control Fig. 7 with image from Kamaid et al., 2015
whole organism morphology, abnormal tgfbr3una202/una202; y1Tg + MO2-tgfbr3 control Fig. 2 with image from Molina-Villa et al., 2021
lymphangioblast cord spatial pattern, abnormal tgfbr3una202/una202; y1Tg + MO2-tgfbr3 control Fig. 2 with image from Molina-Villa et al., 2021
Citations