Morpholino

MO4-thrb

ID
ZDB-MRPHLNO-160429-6
Name
MO4-thrb
Previous Names
None
Target
Sequence
5' - TGGTCCTCACAAGGCAGCTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-thrb
Expressed Gene Anatomy Figures
slc5a5 Fig. 6 with image from Marelli et al., 2016
tg Fig. 6 with image from Marelli et al., 2016
tshba Fig. 6 with image from Marelli et al., 2016
Phenotype
Phenotype resulting from MO4-thrb
Phenotype Fish Figures
embryo development decreased rate, abnormal AB + MO4-thrb Fig. S4 with image from Marelli et al., 2016
eye decreased pigmentation, abnormal AB + MO4-thrb Fig. 3 with image,  Fig. 5 with image from Marelli et al., 2016
hypophysis tshba expression increased amount, abnormal AB + MO4-thrb Fig. 6 with image from Marelli et al., 2016
hypophysis tshba expression increased distribution, abnormal AB + MO4-thrb Fig. 6 with image from Marelli et al., 2016
hypophysis cell increased volume, abnormal AB + MO4-thrb Fig. 6 with image from Marelli et al., 2016
mandibular arch skeleton has fewer parts of type cartilage element, abnormal AB + MO4-thrb Fig. S5 with image from Marelli et al., 2016
notochord morphology, abnormal AB + MO4-thrb Fig. 3 with image from Marelli et al., 2016
post-vent region curved, abnormal AB + MO4-thrb Fig. 3 with image from Marelli et al., 2016
retina disorganized, abnormal AB + MO4-thrb Fig. 5 with image from Marelli et al., 2016
retina morphogenesis in camera-type eye disrupted, abnormal AB + MO4-thrb Fig. 5 with image from Marelli et al., 2016
semicircular canal development disrupted, abnormal AB + MO4-thrb Fig. 5 with image from Marelli et al., 2016
swim bladder uninflated, abnormal AB + MO4-thrb Fig. S5 with image from Marelli et al., 2016
thyroid follicle hyperplastic, abnormal AB + MO4-thrb Fig. 6 with image from Marelli et al., 2016
thyroid follicle tg expression increased amount, abnormal AB + MO4-thrb Fig. 6 with image from Marelli et al., 2016
thyroid follicle slc5a5 expression increased amount, abnormal AB + MO4-thrb Fig. 6 with image from Marelli et al., 2016
thyroid follicle slc5a5 expression increased distribution, abnormal AB + MO4-thrb Fig. 6 with image from Marelli et al., 2016
thyroid follicle ab-t4 labeling increased distribution, abnormal AB + MO4-thrb Fig. 7 with image from Marelli et al., 2016
thyroid follicle tg expression increased distribution, abnormal AB + MO4-thrb Fig. 6 with image from Marelli et al., 2016
thyroid follicle increased size, abnormal AB + MO4-thrb Fig. 6 with image from Marelli et al., 2016
thyroid follicle cell increased amount, abnormal AB + MO4-thrb Fig. 6 with image from Marelli et al., 2016
thyroid follicle cell increased volume, abnormal AB + MO4-thrb Fig. 6 with image from Marelli et al., 2016
thyroid primordium increased size, abnormal AB + MO4-thrb Fig. 6 with image from Marelli et al., 2016
whole organism dead, abnormal AB + MO4-thrb Fig. S5 with image from Marelli et al., 2016
whole organism decreased length, abnormal AB + MO4-thrb Fig. S4 with image from Marelli et al., 2016
whole organism has extra parts of type thyroid follicle, abnormal AB + MO4-thrb Fig. 7 with image from Marelli et al., 2016
whole organism lacks parts or has fewer parts of type otolith, abnormal AB + MO4-thrb Fig. 5 with image from Marelli et al., 2016
whole organism lacks parts or has fewer parts of type semicircular canal, abnormal AB + MO4-thrb Fig. 5 with image from Marelli et al., 2016
whole organism lacks parts or has fewer parts of type pectoral fin, abnormal AB + MO4-thrb Fig. S5 with image from Marelli et al., 2016
Phenotype of all Fish created by or utilizing MO4-thrb
Phenotype Fish Conditions Figures
retina disorganized, abnormal AB + MO4-thrb standard conditions Fig. 5 with image from Marelli et al., 2016
thyroid primordium increased size, abnormal AB + MO4-thrb standard conditions Fig. 6 with image from Marelli et al., 2016
post-vent region curved, abnormal AB + MO4-thrb standard conditions Fig. 3 with image from Marelli et al., 2016
whole organism has extra parts of type thyroid follicle, abnormal AB + MO4-thrb standard conditions Fig. 7 with image from Marelli et al., 2016
retina morphogenesis in camera-type eye disrupted, abnormal AB + MO4-thrb standard conditions Fig. 5 with image from Marelli et al., 2016
mandibular arch skeleton has fewer parts of type cartilage element, abnormal AB + MO4-thrb standard conditions Fig. S5 with image from Marelli et al., 2016
thyroid follicle cell increased amount, abnormal AB + MO4-thrb standard conditions Fig. 6 with image from Marelli et al., 2016
hypophysis tshba expression increased amount, abnormal AB + MO4-thrb standard conditions Fig. 6 with image from Marelli et al., 2016
thyroid follicle cell increased volume, abnormal AB + MO4-thrb standard conditions Fig. 6 with image from Marelli et al., 2016
thyroid follicle tg expression increased amount, abnormal AB + MO4-thrb standard conditions Fig. 6 with image from Marelli et al., 2016
embryo development decreased rate, abnormal AB + MO4-thrb standard conditions Fig. S4 with image from Marelli et al., 2016
thyroid follicle tg expression increased distribution, abnormal AB + MO4-thrb standard conditions Fig. 6 with image from Marelli et al., 2016
hypophysis tshba expression increased distribution, abnormal AB + MO4-thrb standard conditions Fig. 6 with image from Marelli et al., 2016
whole organism decreased length, abnormal AB + MO4-thrb standard conditions Fig. S4 with image from Marelli et al., 2016
whole organism lacks parts or has fewer parts of type semicircular canal, abnormal AB + MO4-thrb standard conditions Fig. 5 with image from Marelli et al., 2016
notochord morphology, abnormal AB + MO4-thrb standard conditions Fig. 3 with image from Marelli et al., 2016
whole organism dead, abnormal AB + MO4-thrb standard conditions Fig. S5 with image from Marelli et al., 2016
hypophysis cell increased volume, abnormal AB + MO4-thrb standard conditions Fig. 6 with image from Marelli et al., 2016
swim bladder uninflated, abnormal AB + MO4-thrb standard conditions Fig. S5 with image from Marelli et al., 2016
semicircular canal development disrupted, abnormal AB + MO4-thrb standard conditions Fig. 5 with image from Marelli et al., 2016
thyroid follicle ab-t4 labeling increased distribution, abnormal AB + MO4-thrb standard conditions Fig. 7 with image from Marelli et al., 2016
thyroid follicle increased size, abnormal AB + MO4-thrb standard conditions Fig. 6 with image from Marelli et al., 2016
whole organism lacks parts or has fewer parts of type pectoral fin, abnormal AB + MO4-thrb standard conditions Fig. S5 with image from Marelli et al., 2016
thyroid follicle hyperplastic, abnormal AB + MO4-thrb standard conditions Fig. 6 with image from Marelli et al., 2016
whole organism lacks parts or has fewer parts of type otolith, abnormal AB + MO4-thrb standard conditions Fig. 5 with image from Marelli et al., 2016
thyroid follicle slc5a5 expression increased distribution, abnormal AB + MO4-thrb standard conditions Fig. 6 with image from Marelli et al., 2016
thyroid follicle slc5a5 expression increased amount, abnormal AB + MO4-thrb standard conditions Fig. 6 with image from Marelli et al., 2016
eye decreased pigmentation, abnormal AB + MO4-thrb standard conditions Fig. 3 with image,  Fig. 5 with image from Marelli et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.