Morpholino

MO3-dnm2a

ID

ZDB-MRPHLNO-160427-3

Name

MO3-dnm2a

Previous Names

Target

Sequence

5' - ACCTACGACAAGGGAAAAATCACAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-dnm2a

No data available

Phenotype

Phenotype resulting from MO3-dnm2a

Phenotype	Fish	Figures
skeletal muscle cell disorganized, abnormal	AB + MO3-dnm2a	Fig. 3 , Fig. 4 from Bragato et al., 2016
skeletal muscle cell increased diameter, abnormal	AB + MO3-dnm2a	Fig. 3 from Bragato et al., 2016
skeletal muscle cell morphology, abnormal	AB + MO3-dnm2a	Fig. 3 from Bragato et al., 2016
skeletal muscle cell nucleus increased amount, abnormal	AB + MO3-dnm2a	Fig. 3 from Bragato et al., 2016
skeletal muscle cell skeletal muscle myofibril disorganized, abnormal	AB + MO3-dnm2a	Fig. 3 from Bragato et al., 2016
somite hypoplastic, abnormal	AB + MO3-dnm2a	Fig. 3 from Bragato et al., 2016
somitogenesis disrupted, abnormal	AB + MO3-dnm2a	Fig. 3 from Bragato et al., 2016
startle response decreased process quality, abnormal	AB + MO3-dnm2a	text only from Bragato et al., 2016
thigmotaxis decreased process quality, abnormal	AB + MO3-dnm2a	text only from Bragato et al., 2016

Phenotype of all Fish created by or utilizing MO3-dnm2a

Phenotype	Fish	Conditions	Figures
somitogenesis disrupted, abnormal	AB + MO3-dnm2a	standard conditions	Fig. 3 from Bragato et al., 2016
thigmotaxis decreased process quality, abnormal	AB + MO3-dnm2a	standard conditions	text only from Bragato et al., 2016
somite hypoplastic, abnormal	AB + MO3-dnm2a	standard conditions	Fig. 3 from Bragato et al., 2016
skeletal muscle cell nucleus increased amount, abnormal	AB + MO3-dnm2a	standard conditions	Fig. 3 from Bragato et al., 2016
skeletal muscle cell morphology, abnormal	AB + MO3-dnm2a	standard conditions	Fig. 3 from Bragato et al., 2016
skeletal muscle cell increased diameter, abnormal	AB + MO3-dnm2a	standard conditions	Fig. 3 from Bragato et al., 2016
startle response decreased process quality, abnormal	AB + MO3-dnm2a	standard conditions	text only from Bragato et al., 2016
skeletal muscle cell skeletal muscle myofibril disorganized, abnormal	AB + MO3-dnm2a	standard conditions	Fig. 3 from Bragato et al., 2016
skeletal muscle cell disorganized, abnormal	AB + MO3-dnm2a	standard conditions	Fig. 3 , Fig. 4 from Bragato et al., 2016

Citations