Morpholino

MO4-sox17

ID
ZDB-MRPHLNO-160415-1
Name
MO4-sox17
Previous Names
None
Target
Sequence
5' - TACCCCGCATCGGGACTGCTCATCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-sox17
Expressed Gene Anatomy Figures
gata1a Fig. 3 from Chung et al., 2011
hbae1.1 Fig. 3 from Chung et al., 2011
lcp1 Fig. 3 from Chung et al., 2011
mpx Fig. 7 from Chung et al., 2011
myb Fig. 7 from Chung et al., 2011
runx1 Fig. 7 from Chung et al., 2011
sox17 Fig. 9 from Chung et al., 2011
Phenotype
Phenotype resulting from MO4-sox17
Phenotype Fish Figures
erythroid lineage cell decreased amount, abnormal WT + MO4-sox17 Fig. 3 from Chung et al., 2011
erythroid lineage cell cell cycle G1/S phase transition delayed, abnormal WT + MO4-sox17 Fig. 5 from Chung et al., 2011
intermediate cell mass of mesoderm hbae1.1 expression decreased amount, abnormal WT + MO4-sox17 Fig. 3 from Chung et al., 2011
intermediate cell mass of mesoderm gata1a expression decreased amount, abnormal WT + MO4-sox17 Fig. 3 from Chung et al., 2011
mesoderm anterior side lcp1 expression decreased amount, abnormal WT + MO4-sox17 Fig. 3 from Chung et al., 2011
primitive hemopoiesis disrupted, abnormal WT + MO4-sox17 Fig. 3 from Chung et al., 2011
whole organism gata1a expression decreased amount, abnormal WT + MO4-sox17 Fig. 3 from Chung et al., 2011
whole organism lcp1 expression decreased amount, abnormal WT + MO4-sox17 Fig. 3 from Chung et al., 2011
whole organism hbae1.1 expression decreased amount, abnormal WT + MO4-sox17 Fig. 3 from Chung et al., 2011
whole organism sox17 expression increased amount, abnormal WT + MO4-sox17 Fig. 9 from Chung et al., 2011
Phenotype of all Fish created by or utilizing MO4-sox17
Phenotype Fish Conditions Figures
primitive hemopoiesis disrupted, abnormal WT + MO4-sox17 standard conditions Fig. 3 from Chung et al., 2011
whole organism sox17 expression increased amount, abnormal WT + MO4-sox17 standard conditions Fig. 9 from Chung et al., 2011
whole organism lcp1 expression decreased amount, abnormal WT + MO4-sox17 standard conditions Fig. 3 from Chung et al., 2011
erythroid lineage cell cell cycle G1/S phase transition delayed, abnormal WT + MO4-sox17 standard conditions Fig. 5 from Chung et al., 2011
erythroid lineage cell decreased amount, abnormal WT + MO4-sox17 standard conditions Fig. 3 from Chung et al., 2011
intermediate cell mass of mesoderm gata1a expression decreased amount, abnormal WT + MO4-sox17 standard conditions Fig. 3 from Chung et al., 2011
whole organism hbae1.1 expression decreased amount, abnormal WT + MO4-sox17 standard conditions Fig. 3 from Chung et al., 2011
mesoderm anterior side lcp1 expression decreased amount, abnormal WT + MO4-sox17 standard conditions Fig. 3 from Chung et al., 2011
intermediate cell mass of mesoderm hbae1.1 expression decreased amount, abnormal WT + MO4-sox17 standard conditions Fig. 3 from Chung et al., 2011
whole organism gata1a expression decreased amount, abnormal WT + MO4-sox17 standard conditions Fig. 3 from Chung et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.