header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-160415-1
Morpholino Name: MO4-sox17
Target: sox17 (1)
Sequence:
5' - TACCCCGCATCGGGACTGCTCATCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-sox17 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-sox17
Expressed Gene Anatomy Figures
gata1a Fig. 3 from Chung et al., 2011
hbae1.1 Fig. 3 from Chung et al., 2011
lcp1 Fig. 3 from Chung et al., 2011
mpx Fig. 7 from Chung et al., 2011
myb Fig. 7 from Chung et al., 2011
runx1 Fig. 7 from Chung et al., 2011
sox17 Fig. 9 from Chung et al., 2011
PHENOTYPE
Phenotype resulting from MO4-sox17
Phenotype of all Fish created by or utilizing MO4-sox17
Genome Resources:
CITATIONS (1)