Morpholino
MO3-myo5b
- ID
- ZDB-MRPHLNO-160310-1
- Name
- MO3-myo5b
- Previous Names
- None
- Target
- Sequence
-
5' - GCTTTACTGCCATCCGAGTGCAAGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-myo5b
No data available
Phenotype
Phenotype resulting from MO3-myo5b
Phenotype of all Fish created by or utilizing MO3-myo5b
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| cranial nerve II decreased width, abnormal | s1984tTg; s1992tTg + MO3-myo5b | control |
Fig. 8
from Liu et al., 2013 |
| cranial nerve II has fewer parts of type retinal ganglion cell axon, abnormal | s1984tTg; s1992tTg + MO3-myo5b | control |
Fig. 8
from Liu et al., 2013 |
1 - 2 of 2
Citations
- Gupta, K., Mukherjee, S., Sen, S., Sonawane, M. (2022) Coordinated activities of Myosin Vb isoforms and mTOR signaling regulate epithelial cell morphology during development. Development (Cambridge, England). 149(6)
- Liu, Y., Xu, X.H., Chen, Q., Wang, T., Deng, C.Y., Song, B.L., Du, J.L., and Luo, Z.G. (2013) Myosin Vb controls biogenesis of post-Golgi Rab10 carriers during axon development. Nature communications. 4:2005
1 - 2 of 2
Show