Morpholino

MO3-nanog

ID
ZDB-MRPHLNO-160309-3
Name
MO3-nanog
Previous Names
None
Target
Sequence
5' - ATCTTCCAGTCCGCCATTTCGCCGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-nanog
Expressed Gene Anatomy Figures
bmp4 Fig. 3 from Schuff et al., 2012
cxcr4b Fig. 3 from Schuff et al., 2012
gata4 Fig. 3 from Schuff et al., 2012
gata6 Fig. 3 from Schuff et al., 2012
gsc Fig. 3 from Schuff et al., 2012
pax2a Fig. 3 from Schuff et al., 2012
pou5f3 Fig. 3 from Schuff et al., 2012
ved Fig. 3 from Schuff et al., 2012
vent Fig. 3 from Schuff et al., 2012
vox Fig. 3 from Schuff et al., 2012
Phenotype
Phenotype resulting from MO3-nanog
Phenotype Fish Figures
epiblast increased thickness, abnormal WT + MO3-nanog Fig. 3 from Schuff et al., 2012
epiboly involved in gastrulation with mouth forming second disrupted, abnormal WT + MO3-nanog Fig. 3,  Fig. 6 from Schuff et al., 2012
whole organism ved expression decreased amount, abnormal WT + MO3-nanog Fig. 3 from Schuff et al., 2012
whole organism pou5f3 expression decreased amount, abnormal WT + MO3-nanog Fig. 3 from Schuff et al., 2012
whole organism vent expression decreased amount, abnormal WT + MO3-nanog Fig. 3 from Schuff et al., 2012
whole organism gata6 expression decreased amount, abnormal WT + MO3-nanog Fig. 3 from Schuff et al., 2012
whole organism vox expression decreased amount, abnormal WT + MO3-nanog Fig. 3 from Schuff et al., 2012
whole organism gsc expression decreased amount, abnormal WT + MO3-nanog Fig. 3 from Schuff et al., 2012
whole organism gata4 expression decreased amount, abnormal WT + MO3-nanog Fig. 3 from Schuff et al., 2012
whole organism cxcr4b expression increased amount, abnormal WT + MO3-nanog Fig. 3 from Schuff et al., 2012
whole organism pax2a expression increased amount, abnormal WT + MO3-nanog Fig. 3 from Schuff et al., 2012
whole organism ventral region ved expression decreased distribution, abnormal WT + MO3-nanog Fig. 3 from Schuff et al., 2012
whole organism ventral region vent expression decreased distribution, abnormal WT + MO3-nanog Fig. 3 from Schuff et al., 2012
Phenotype of all Fish created by or utilizing MO3-nanog
Phenotype Fish Conditions Figures
whole organism gata4 expression decreased amount, abnormal WT + MO3-nanog standard conditions Fig. 3 from Schuff et al., 2012
whole organism gata6 expression decreased amount, abnormal WT + MO3-nanog standard conditions Fig. 3 from Schuff et al., 2012
whole organism pou5f3 expression decreased amount, abnormal WT + MO3-nanog standard conditions Fig. 3 from Schuff et al., 2012
epiboly involved in gastrulation with mouth forming second disrupted, abnormal WT + MO3-nanog standard conditions Fig. 3,  Fig. 6 from Schuff et al., 2012
whole organism gsc expression decreased amount, abnormal WT + MO3-nanog standard conditions Fig. 3 from Schuff et al., 2012
whole organism ventral region ved expression decreased distribution, abnormal WT + MO3-nanog standard conditions Fig. 3 from Schuff et al., 2012
whole organism vent expression decreased amount, abnormal WT + MO3-nanog standard conditions Fig. 3 from Schuff et al., 2012
whole organism cxcr4b expression increased amount, abnormal WT + MO3-nanog standard conditions Fig. 3 from Schuff et al., 2012
whole organism ved expression decreased amount, abnormal WT + MO3-nanog standard conditions Fig. 3 from Schuff et al., 2012
epiblast increased thickness, abnormal WT + MO3-nanog standard conditions Fig. 3 from Schuff et al., 2012
whole organism vox expression decreased amount, abnormal WT + MO3-nanog standard conditions Fig. 3 from Schuff et al., 2012
whole organism pax2a expression increased amount, abnormal WT + MO3-nanog standard conditions Fig. 3 from Schuff et al., 2012
whole organism ventral region vent expression decreased distribution, abnormal WT + MO3-nanog standard conditions Fig. 3 from Schuff et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.