Morpholino

MO2-ddx11

ID

ZDB-MRPHLNO-160307-2

Name

MO2-ddx11

Previous Names

None

Target

Sequence

5' - AACCGGCCATTTTTGCTCTCCATTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-ddx11

No data available

Phenotype

Phenotype resulting from MO2-ddx11

Phenotype	Fish	Figures
eye decreased distance eye, abnormal	WT + MO2-ddx11	Fig. 8 from Sun et al., 2015
eye decreased size, abnormal	WT + MO2-ddx11	Fig. 8 from Sun et al., 2015
head anterior region increased length, abnormal	WT + MO2-ddx11	Fig. 8 from Sun et al., 2015
mouth decreased position, abnormal	WT + MO2-ddx11	Fig. 8 from Sun et al., 2015
mouth protruding, abnormal	WT + MO2-ddx11	Fig. 8 from Sun et al., 2015
nucleolar chromatin organization process quality, abnormal	WT + MO2-ddx11	Fig. 8 from Sun et al., 2015
regulation of transcription of nucleolar large rRNA by RNA polymerase I decreased process quality, abnormal	WT + MO2-ddx11	Fig. 8 from Sun et al., 2015
rRNA transcription decreased process quality, abnormal	WT + MO2-ddx11	Fig. 8 from Sun et al., 2015
trunk curved caudal, abnormal	WT + MO2-ddx11	Fig. 8 from Sun et al., 2015
whole organism decreased length, abnormal	WT + MO2-ddx11	Fig. 8 from Sun et al., 2015

Phenotype of all Fish created by or utilizing MO2-ddx11

Phenotype	Fish	Conditions	Figures
head anterior region increased length, abnormal	WT + MO2-ddx11	standard conditions	Fig. 8 from Sun et al., 2015
mouth protruding, abnormal	WT + MO2-ddx11	standard conditions	Fig. 8 from Sun et al., 2015
eye decreased distance eye, abnormal	WT + MO2-ddx11	standard conditions	Fig. 8 from Sun et al., 2015
whole organism decreased length, abnormal	WT + MO2-ddx11	standard conditions	Fig. 8 from Sun et al., 2015
mouth decreased position, abnormal	WT + MO2-ddx11	standard conditions	Fig. 8 from Sun et al., 2015
eye decreased size, abnormal	WT + MO2-ddx11	standard conditions	Fig. 8 from Sun et al., 2015
trunk curved caudal, abnormal	WT + MO2-ddx11	standard conditions	Fig. 8 from Sun et al., 2015
rRNA transcription decreased process quality, abnormal	WT + MO2-ddx11	standard conditions	Fig. 8 from Sun et al., 2015
nucleolar chromatin organization process quality, abnormal	WT + MO2-ddx11	standard conditions	Fig. 8 from Sun et al., 2015
regulation of transcription of nucleolar large rRNA by RNA polymerase I decreased process quality, abnormal	WT + MO2-ddx11	standard conditions	Fig. 8 from Sun et al., 2015

Citations