Morpholino

MO1-ddx11

ID

ZDB-MRPHLNO-160307-1

Name

MO1-ddx11

Previous Names

None

Target

Sequence

5' - GCCGAATAACACGAAAATCAACACT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Targets the 5'UTR.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-ddx11

No data available

Phenotype

Phenotype resulting from MO1-ddx11

Phenotype	Fish	Figures
eye decreased distance eye, abnormal	WT + MO1-ddx11	Fig. 8 from Sun et al., 2015
eye decreased size, abnormal	WT + MO1-ddx11	Fig. 8 from Sun et al., 2015
head anterior region increased length, abnormal	WT + MO1-ddx11	Fig. 8 from Sun et al., 2015
mouth decreased position, abnormal	WT + MO1-ddx11	Fig. 8 from Sun et al., 2015
mouth protruding, abnormal	WT + MO1-ddx11	Fig. 8 from Sun et al., 2015
nucleolar chromatin organization process quality, abnormal	WT + MO1-ddx11	Fig. 8 from Sun et al., 2015
regulation of transcription of nucleolar large rRNA by RNA polymerase I decreased process quality, abnormal	WT + MO1-ddx11	Fig. 8 from Sun et al., 2015
rRNA transcription decreased process quality, abnormal	WT + MO1-ddx11	Fig. 8 from Sun et al., 2015
trunk curved caudal, abnormal	WT + MO1-ddx11	Fig. 8 from Sun et al., 2015
whole organism decreased length, abnormal	WT + MO1-ddx11	Fig. 8 from Sun et al., 2015

Phenotype of all Fish created by or utilizing MO1-ddx11

Phenotype	Fish	Conditions	Figures
eye decreased distance eye, abnormal	WT + MO1-ddx11	standard conditions	Fig. 8 from Sun et al., 2015
mouth decreased position, abnormal	WT + MO1-ddx11	standard conditions	Fig. 8 from Sun et al., 2015
mouth protruding, abnormal	WT + MO1-ddx11	standard conditions	Fig. 8 from Sun et al., 2015
whole organism decreased length, abnormal	WT + MO1-ddx11	standard conditions	Fig. 8 from Sun et al., 2015
head anterior region increased length, abnormal	WT + MO1-ddx11	standard conditions	Fig. 8 from Sun et al., 2015
eye decreased size, abnormal	WT + MO1-ddx11	standard conditions	Fig. 8 from Sun et al., 2015
regulation of transcription of nucleolar large rRNA by RNA polymerase I decreased process quality, abnormal	WT + MO1-ddx11	standard conditions	Fig. 8 from Sun et al., 2015
trunk curved caudal, abnormal	WT + MO1-ddx11	standard conditions	Fig. 8 from Sun et al., 2015
rRNA transcription decreased process quality, abnormal	WT + MO1-ddx11	standard conditions	Fig. 8 from Sun et al., 2015
nucleolar chromatin organization process quality, abnormal	WT + MO1-ddx11	standard conditions	Fig. 8 from Sun et al., 2015

Citations