header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-160211-6
Morpholino Name: MO1-iqcg
Target: iqcg (1)
Sequence:
5' - TCCTCCACGGACATCATACTGCTAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-iqcg No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-iqcg
Expressed Gene Anatomy Figures
gata1a Fig. S1 from Chen et al., 2014
hbae1.1 Fig. S1 from Chen et al., 2014
myb Fig. 1 from Chen et al., 2014
runx1 Fig. 1 from Chen et al., 2014
spi1b Fig. S1 from Chen et al., 2014
tal1 Fig. S1 from Chen et al., 2014
PHENOTYPE
Phenotype resulting from MO1-iqcg
Phenotype of all Fish created by or utilizing MO1-iqcg
Phenotype Fish Conditions Figures
ventral wall of dorsal aorta myb expression decreased amount, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
hematopoietic stem cell myb expression decreased amount, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
thymus myb expression decreased amount, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
hematopoietic stem cell decreased amount, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
nucleate erythrocyte decreased amount, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
kidney myb expression decreased amount, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
blood island disorganized, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
definitive hemopoiesis disrupted, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
monocyte decreased amount, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
lymphocyte decreased amount, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
blood island decreased size, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
erythrocyte differentiation disrupted, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
caudal artery decreased distance caudal vein, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
common myeloid progenitor myb expression decreased amount, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
neutrophil decreased amount, abnormal WT + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
common myeloid progenitor EGFP expression decreased amount, abnormal zf169Tg + MO1-iqcg standard conditions Fig. 1Fig. S1 from Chen et al., 2014
hematopoietic stem cell EGFP expression decreased amount, abnormal zf169Tg + MO1-iqcg standard conditions Fig. 1Fig. S1 from Chen et al., 2014
definitive hemopoiesis disrupted, abnormal zf169Tg + MO1-iqcg standard conditions Fig. 1 from Chen et al., 2014
blood island cell population proliferation disrupted, abnormal zf169Tg + MO1-iqcg standard conditions Fig. 3 from Chen et al., 2014
definitive hemopoiesis disrupted, abnormal WT + MO1-hsp70l + MO1-iqcg standard conditions Fig. S5 from Chen et al., 2014
OTHER MO1-iqcg MORPHOLINO PAGESNo links to external sites
CITATIONS (1)