Morpholino

MO2-klc2

ID
ZDB-MRPHLNO-160210-6
Name
MO2-klc2
Previous Names
  • MOklc-SP (1)
Target
Sequence
5' - CGTGTGTGTTTCACCTGTGCTTCCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-klc2
Expressed Gene Anatomy Figures
dio2 Fig. 4 from Martín et al., 2021
slc5a5 Fig. 4 from Martín et al., 2021
tg Fig. 4 from Martín et al., 2021
tshba Fig. 4 from Martín et al., 2021
ugt1ab Fig. 4 from Martín et al., 2021
Phenotype
Phenotype resulting from MO2-klc2
Phenotype Fish Figures
post-vent region curved, abnormal WT + MO2-klc2 Fig. 2 from Melo et al., 2015
post-vent region kinked, abnormal WT + MO2-klc2 Fig. 2 from Melo et al., 2015
swimming behavior disrupted, abnormal WT + MO2-klc2 Fig. 2 from Melo et al., 2015
thyroid follicle ab-t4 labeling decreased amount, abnormal WT + MO2-klc2 Fig. 4 from Martín et al., 2021
thyroid follicle thyroxine decreased amount, abnormal WT + MO2-klc2 Fig. 4 from Martín et al., 2021
whole organism dead, abnormal WT + MO2-klc2 Fig. 2 from Melo et al., 2015
whole organism dio2 expression increased amount, abnormal WT + MO2-klc2 Fig. 4 from Martín et al., 2021
whole organism tg expression increased amount, abnormal WT + MO2-klc2 Fig. 4 from Martín et al., 2021
whole organism slc5a5 expression increased amount, abnormal WT + MO2-klc2 Fig. 4 from Martín et al., 2021
whole organism ugt1ab expression increased amount, abnormal WT + MO2-klc2 Fig. 4 from Martín et al., 2021
whole organism tshba expression increased amount, abnormal WT + MO2-klc2 Fig. 4 from Martín et al., 2021
Phenotype of all Fish created by or utilizing MO2-klc2
Phenotype Fish Conditions Figures
whole organism ugt1ab expression increased amount, abnormal WT + MO2-klc2 standard conditions Fig. 4 from Martín et al., 2021
whole organism tg expression increased amount, abnormal WT + MO2-klc2 standard conditions Fig. 4 from Martín et al., 2021
whole organism dio2 expression increased amount, abnormal WT + MO2-klc2 standard conditions Fig. 4 from Martín et al., 2021
swimming behavior disrupted, abnormal WT + MO2-klc2 standard conditions Fig. 2 from Melo et al., 2015
whole organism dead, abnormal WT + MO2-klc2 standard conditions Fig. 2 from Melo et al., 2015
thyroid follicle ab-t4 labeling decreased amount, abnormal WT + MO2-klc2 standard conditions Fig. 4 from Martín et al., 2021
thyroid follicle thyroxine decreased amount, abnormal WT + MO2-klc2 standard conditions Fig. 4 from Martín et al., 2021
post-vent region curved, abnormal WT + MO2-klc2 standard conditions Fig. 2 from Melo et al., 2015
post-vent region kinked, abnormal WT + MO2-klc2 standard conditions Fig. 2 from Melo et al., 2015
whole organism slc5a5 expression increased amount, abnormal WT + MO2-klc2 standard conditions Fig. 4 from Martín et al., 2021
whole organism tshba expression increased amount, abnormal WT + MO2-klc2 standard conditions Fig. 4 from Martín et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.