Morpholino

MO1-lnx2a

ID
ZDB-MRPHLNO-160119-3
Name
MO1-lnx2a
Previous Names
None
Target
Sequence
5' - TTGAGAACTTTACCTGTGTTTGAGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lnx2a
Expressed Gene Anatomy Figures
foxa3 Fig. S2 with image from Won et al., 2015
gata6 Fig. S2 with image from Won et al., 2015
gcga Fig. 2 with image,  Fig. 5 with image,  Fig. S2 with image from Won et al., 2015
hhex Fig. S2 with image from Won et al., 2015
ins Fig. 2 with image,  Fig. 5 with image,  Fig. S2 with image from Won et al., 2015
mnx2a Fig. S2 with image,  Fig. S7 with image from Won et al., 2015
numb Fig. 6 with image,  Fig. 7 with image from Won et al., 2015
pdx1 Fig. S2 with image from Won et al., 2015
prss1 Fig. 2 with image,  Fig. 5 with image from Won et al., 2015
ptf1a Fig. 2 with image,  Fig. 5 with image,  Fig. S2 with image,  Fig. S7 with image from Won et al., 2015
Phenotype
Phenotype resulting from MO1-lnx2a
Phenotype Fish Figures
anterior pancreatic bud EGFP expression decreased distribution, abnormal jh1Tg + MO1-lnx2a Fig. 7 with image,  Fig. S2 with image from Won et al., 2015
anterior pancreatic bud ptf1a expression decreased distribution, abnormal AB + MO1-lnx2a Fig. S2 with image,  Fig. S7 with image from Won et al., 2015
anterior pancreatic bud mnx2a expression decreased distribution, abnormal AB + MO1-lnx2a Fig. S2 with image,  Fig. S7 with image from Won et al., 2015
anterior pancreatic bud cell population proliferation decreased process quality, abnormal jh1Tg + MO1-lnx2a Fig. 7 with image from Won et al., 2015
exocrine pancreas prss1 expression decreased amount, abnormal AB + MO1-lnx2a Fig. 2 with image,  Fig. 5 with image from Won et al., 2015
exocrine pancreas ptf1a expression decreased amount, abnormal AB + MO1-lnx2a Fig. 2 with image,  Fig. 5 with image from Won et al., 2015
exocrine pancreas ptf1a expression decreased distribution, abnormal AB + MO1-lnx2a Fig. 2 with image,  Fig. 5 with image from Won et al., 2015
exocrine pancreas prss1 expression decreased distribution, abnormal AB + MO1-lnx2a Fig. 2 with image,  Fig. 5 with image from Won et al., 2015
exocrine pancreas development decreased process quality, abnormal AB + MO1-lnx2a Fig. S5 with image,  Fig. S7 with image from Won et al., 2015
exocrine pancreas development disrupted, abnormal AB + MO1-lnx2a Fig. 2 with image,  Fig. 5 with image from Won et al., 2015
pancreas mCherry expression decreased distribution, abnormal s939Tg; s940Tg + MO1-lnx2a Fig. 6 with image from Won et al., 2015
pancreas Venus expression decreased distribution, abnormal s939Tg; s940Tg + MO1-lnx2a Fig. 6 with image from Won et al., 2015
pancreas numb expression increased distribution, abnormal s939Tg; s940Tg + MO1-lnx2a Fig. 6 with image from Won et al., 2015
pancreatic bud numb expression increased distribution, abnormal jh1Tg + MO1-lnx2a Fig. 7 with image from Won et al., 2015
Phenotype of all Fish created by or utilizing MO1-lnx2a
Phenotype Fish Conditions Figures
exocrine pancreas ptf1a expression decreased amount, abnormal AB + MO1-lnx2a control Fig. 2 with image,  Fig. 5 with image from Won et al., 2015
anterior pancreatic bud ptf1a expression decreased distribution, abnormal AB + MO1-lnx2a control Fig. S2 with image,  Fig. S7 with image from Won et al., 2015
exocrine pancreas development decreased process quality, abnormal AB + MO1-lnx2a control Fig. S5 with image,  Fig. S7 with image from Won et al., 2015
exocrine pancreas development disrupted, abnormal AB + MO1-lnx2a control Fig. 2 with image,  Fig. 5 with image from Won et al., 2015
exocrine pancreas ptf1a expression decreased distribution, abnormal AB + MO1-lnx2a control Fig. 2 with image,  Fig. 5 with image from Won et al., 2015
exocrine pancreas prss1 expression decreased amount, abnormal AB + MO1-lnx2a control Fig. 2 with image,  Fig. 5 with image from Won et al., 2015
anterior pancreatic bud mnx2a expression decreased distribution, abnormal AB + MO1-lnx2a control Fig. S2 with image,  Fig. S7 with image from Won et al., 2015
exocrine pancreas prss1 expression decreased distribution, abnormal AB + MO1-lnx2a control Fig. 2 with image,  Fig. 5 with image from Won et al., 2015
anterior pancreatic bud EGFP expression decreased distribution, abnormal jh1Tg + MO1-lnx2a control Fig. 7 with image,  Fig. S2 with image from Won et al., 2015
anterior pancreatic bud cell population proliferation decreased process quality, abnormal jh1Tg + MO1-lnx2a control Fig. 7 with image from Won et al., 2015
pancreatic bud numb expression increased distribution, abnormal jh1Tg + MO1-lnx2a control Fig. 7 with image from Won et al., 2015
pancreas mCherry expression decreased distribution, abnormal s939Tg; s940Tg + MO1-lnx2a control Fig. 6 with image from Won et al., 2015
pancreas numb expression increased distribution, abnormal s939Tg; s940Tg + MO1-lnx2a control Fig. 6 with image from Won et al., 2015
pancreas Venus expression decreased distribution, abnormal s939Tg; s940Tg + MO1-lnx2a control Fig. 6 with image from Won et al., 2015
exocrine pancreas development process quality, ameliorated AB + MO1-lnx2a + MO4-numb standard conditions Fig. 5 with image,  Fig. S5 with image from Won et al., 2015
exocrine pancreas ptf1a expression amount, ameliorated AB + MO1-lnx2a + MO4-numb control Fig. 5 with image from Won et al., 2015
exocrine pancreas prss1 expression amount, ameliorated AB + MO1-lnx2a + MO4-numb control Fig. 5 with image from Won et al., 2015
exocrine pancreas prss1 expression spatial pattern, ameliorated AB + MO1-lnx2a + MO4-numb control Fig. 5 with image from Won et al., 2015
exocrine pancreas ptf1a expression spatial pattern, ameliorated AB + MO1-lnx2a + MO4-numb control Fig. 5 with image from Won et al., 2015
pancreas Venus expression spatial pattern, ameliorated s939Tg; s940Tg + MO1-lnx2a + MO4-numb control Fig. 6 with image from Won et al., 2015
pancreas numb expression spatial pattern, ameliorated s939Tg; s940Tg + MO1-lnx2a + MO4-numb control Fig. 6 with image from Won et al., 2015
pancreas mCherry expression spatial pattern, ameliorated s939Tg; s940Tg + MO1-lnx2a + MO4-numb control Fig. 6 with image from Won et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.