Morpholino

MO2-mt2

ID
ZDB-MRPHLNO-160114-3
Name
MO2-mt2
Previous Names
None
Target
Sequence
5' - AGCTGAAACACTTACTCTTGGCACA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-mt2
No data available
Phenotype
Phenotype resulting from MO2-mt2
Phenotype Fish Figures
anterior cardinal vein endothelial cell decreased amount, abnormal s843Tg + MO2-mt2 Fig. S1 from Schuermann et al., 2015
common cardinal vein malformed, abnormal s843Tg + MO2-mt2 Fig. S1 from Schuermann et al., 2015
common cardinal vein blood vessel development decreased occurrence, abnormal s843Tg + MO2-mt2 Fig. S1 from Schuermann et al., 2015
common cardinal vein endothelial cell decreased amount, abnormal s843Tg + MO2-mt2 Fig. S1 from Schuermann et al., 2015
head vegfc expression decreased amount, abnormal WT + MO2-mt2 Fig. 4 from Schuermann et al., 2015
intersegmental vessel malformed, abnormal s843Tg + MO2-mt2 Fig. S1 from Schuermann et al., 2015
intersegmental vessel blood vessel development decreased occurrence, abnormal s843Tg + MO2-mt2 Fig. S1 from Schuermann et al., 2015
intersegmental vessel endothelial cell decreased amount, abnormal s843Tg + MO2-mt2 Fig. S1 from Schuermann et al., 2015
posterior cardinal vein endothelial cell decreased amount, abnormal s843Tg + MO2-mt2 Fig. S1 from Schuermann et al., 2015
primordial hindbrain channel aplastic, abnormal s843Tg + MO2-mt2 Fig. S1 from Schuermann et al., 2015
primordial hindbrain channel angiogenesis arrested, abnormal s843Tg + MO2-mt2 Fig. S1 from Schuermann et al., 2015
primordial hindbrain channel endothelial cell decreased amount, abnormal y7Tg + MO2-mt2 Fig. 1 from Schuermann et al., 2015
whole organism vegfc expression decreased amount, abnormal WT + MO2-mt2 Fig. 4 from Schuermann et al., 2015
Phenotype of all Fish created by or utilizing MO2-mt2
Phenotype Fish Conditions Figures
head vegfc expression decreased amount, abnormal WT + MO2-mt2 standard conditions Fig. 4 from Schuermann et al., 2015
whole organism vegfc expression decreased amount, abnormal WT + MO2-mt2 standard conditions Fig. 4 from Schuermann et al., 2015
common cardinal vein blood vessel development decreased occurrence, abnormal s843Tg + MO2-mt2 control Fig. S1 from Schuermann et al., 2015
anterior cardinal vein endothelial cell decreased amount, abnormal s843Tg + MO2-mt2 control Fig. S1 from Schuermann et al., 2015
primordial hindbrain channel angiogenesis arrested, abnormal s843Tg + MO2-mt2 control Fig. S1 from Schuermann et al., 2015
intersegmental vessel malformed, abnormal s843Tg + MO2-mt2 control Fig. S1 from Schuermann et al., 2015
intersegmental vessel endothelial cell decreased amount, abnormal s843Tg + MO2-mt2 control Fig. S1 from Schuermann et al., 2015
posterior cardinal vein endothelial cell decreased amount, abnormal s843Tg + MO2-mt2 control Fig. S1 from Schuermann et al., 2015
intersegmental vessel blood vessel development decreased occurrence, abnormal s843Tg + MO2-mt2 control Fig. S1 from Schuermann et al., 2015
common cardinal vein malformed, abnormal s843Tg + MO2-mt2 control Fig. S1 from Schuermann et al., 2015
primordial hindbrain channel aplastic, abnormal s843Tg + MO2-mt2 control Fig. S1 from Schuermann et al., 2015
common cardinal vein endothelial cell decreased amount, abnormal s843Tg + MO2-mt2 control Fig. S1 from Schuermann et al., 2015
primordial hindbrain channel endothelial cell decreased amount, abnormal y7Tg + MO2-mt2 standard conditions Fig. 1 from Schuermann et al., 2015
Citations