Morpholino

MO1-myo18aa

ID
ZDB-MRPHLNO-151217-2
Name
MO1-myo18aa
Previous Names
  • exon 10 splice acceptor (1)
Target
Sequence
5' - GTTTAGACACTGGTAGCTTTACCTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-myo18aa
No data available
Phenotype
Phenotype resulting from MO1-myo18aa
Phenotype of all Fish created by or utilizing MO1-myo18aa
Phenotype Fish Conditions Figures
somite border ab1-dag1 labeling spatial pattern, abnormal WT + MO1-myo18aa standard conditions Fig. 3 from Cao et al., 2014
muscle cell detached from myotome, abnormal WT + MO1-myo18aa standard conditions Fig. 3 from Cao et al., 2014
muscle cell misaligned with somite, abnormal WT + MO1-myo18aa standard conditions Fig. 3 from Cao et al., 2014
swimming behavior process quality, abnormal WT + MO1-myo18aa standard conditions Fig. S2 from Cao et al., 2014
trunk bent, abnormal WT + MO1-myo18aa standard conditions Fig. 2 from Cao et al., 2014
somite border irregular spatial pattern, abnormal WT + MO1-myo18aa standard conditions Fig. 2 from Cao et al., 2014
somite border dmd expression spatial pattern, abnormal WT + MO1-myo18aa standard conditions Fig. 3 from Cao et al., 2014
somite patchy, abnormal WT + MO1-myo18aa standard conditions Fig. 3 from Cao et al., 2014
whole organism anterior-posterior axis shortened, abnormal WT + MO1-myo18aa standard conditions Fig. 2 from Cao et al., 2014
muscle cell disorganized, abnormal WT + MO1-myo18aa standard conditions Fig. 2Fig. 3 from Cao et al., 2014
head decreased size, abnormal WT + MO1-myo18aa standard conditions Fig. 2 from Cao et al., 2014
eye decreased size, abnormal WT + MO1-myo18aa standard conditions Fig. 2 from Cao et al., 2014
thigmotaxis disrupted, abnormal WT + MO1-myo18aa standard conditions Fig. S2 from Cao et al., 2014
muscle cell detached from somite border, abnormal WT + MO1-myo18aa + MO1-myo18ab standard conditions Fig. 4 from Cao et al., 2014
muscle cell disorganized, abnormal WT + MO1-myo18aa + MO1-myo18ab standard conditions Fig. 4 from Cao et al., 2014
myotome anatomical boundary ab-f310 labeling spatial pattern, abnormal WT + MO1-myo18aa + MO1-myo18ab standard conditions Fig. 4 from Cao et al., 2014
myoblast cell-matrix adhesion arrested, abnormal WT + MO1-myo18aa + MO1-myo18ab primary cell culture: somite Fig. 6 with image from Cao et al., 2016
somite border dmd expression spatial pattern, abnormal WT + MO1-myo18aa + MO1-myo18ab standard conditions Fig. 3 from Cao et al., 2014
myoblast Golgi apparatus morphology, abnormal WT + MO1-myo18aa + MO1-myo18ab primary cell culture: somite Fig. 7 with image from Cao et al., 2016
myoblast cell-matrix adhesion decreased occurrence, abnormal WT + MO1-myo18aa + MO1-myo18ab primary cell culture: somite Fig. 6 with image from Cao et al., 2016
somite border ab1-dag1 labeling spatial pattern, abnormal WT + MO1-myo18aa + MO1-myo18ab standard conditions Fig. 3 from Cao et al., 2014
Citations