Morpholino
MO1-amotl2b
- ID
- ZDB-MRPHLNO-151216-3
- Name
- MO1-amotl2b
- Previous Names
- None
- Target
- Sequence
-
5' - TGAGTATTTATGATCTGAGCTGAAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-amotl2b
No data available
Phenotype
Phenotype resulting from MO1-amotl2b
No data available
Phenotype of all Fish created by or utilizing MO1-amotl2b
1 - 5 of 34 Show all
Citations
- Hildebrand, S., Hultin, S., Subramani, A., Petropoulos, S., Zhang, Y., Cao, X., Mpindi, J., Kalloniemi, O., Johansson, S., Majumdar, A., Lanner, F., Holmgren, L. (2017) The E-cadherin/AmotL2 complex organizes actin filaments required for epithelial hexagonal packing and blastocyst hatching. Scientific Reports. 7:9540
- Hultin, S., Subramani, A., Hildebrand, S., Zheng, Y., Majumdar, A., Holmgren, L. (2017) AmotL2 integrates polarity and junctional cues to modulate cell shape. Scientific Reports. 7:7548
- Hultin, S., Zheng, Y., Mojallal, M., Vertuani, S., Gentili, C., Balland, M., Milloud, R., Belting, H.G., Affolter, M., Helker, C.S., Adams, R.H., Herzog, W., Uhlen, P., Majumdar, A., Holmgren, L. (2014) AmotL2 links VE-cadherin to contractile actin fibres necessary for aortic lumen expansion. Nature communications. 5:3743
1 - 3 of 3
Show