Morpholino

MO2-chd5

ID
ZDB-MRPHLNO-151208-6
Name
MO2-chd5
Previous Names
  • chd5MO1 (1)
Target
Sequence
5' - CGGGCATCTTTACCGCATAACAAGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-chd5
No data available
Phenotype
Phenotype resulting from MO2-chd5
Phenotype Fish Figures
diencephalon dorsal region fgf8a expression increased amount, abnormal WT + MO2-chd5 Fig. 8 from Bishop et al., 2015
eye decreased size, abnormal WT + MO2-chd5 Fig. 4,  Fig. 5 from Bishop et al., 2015
head decreased size, abnormal WT + MO2-chd5 Fig. 4,  Fig. 5 from Bishop et al., 2015
head cell death increased occurrence, abnormal WT + MO2-chd5 Fig. 7 from Bishop et al., 2015
hindbrain pax6a expression decreased amount, abnormal WT + MO2-chd5 Fig. 8 from Bishop et al., 2015
midbrain otx2b expression decreased amount, abnormal WT + MO2-chd5 Fig. 8 from Bishop et al., 2015
optic stalk fgf8a expression increased amount, abnormal WT + MO2-chd5 Fig. 8 from Bishop et al., 2015
retina dopaminergic neuron th expression decreased amount, abnormal WT + MO2-chd5 Fig. 9 from Bishop et al., 2015
splanchnocranium absent, abnormal WT + MO2-chd5 Fig. 6 from Bishop et al., 2015
telencephalon pax6a expression decreased amount, abnormal WT + MO2-chd5 Fig. 8 from Bishop et al., 2015
telencephalon fgf8a expression increased amount, abnormal WT + MO2-chd5 Fig. 8 from Bishop et al., 2015
trunk cell death increased occurrence, abnormal WT + MO2-chd5 Fig. 7 from Bishop et al., 2015
Phenotype of all Fish created by or utilizing MO2-chd5
Phenotype Fish Conditions Figures
head decreased size, abnormal WT + MO2-chd5 control Fig. 4,  Fig. 5 from Bishop et al., 2015
diencephalon dorsal region fgf8a expression increased amount, abnormal WT + MO2-chd5 control Fig. 8 from Bishop et al., 2015
eye decreased size, abnormal WT + MO2-chd5 control Fig. 4,  Fig. 5 from Bishop et al., 2015
telencephalon fgf8a expression increased amount, abnormal WT + MO2-chd5 control Fig. 8 from Bishop et al., 2015
retina dopaminergic neuron th expression decreased amount, abnormal WT + MO2-chd5 control Fig. 9 from Bishop et al., 2015
telencephalon pax6a expression decreased amount, abnormal WT + MO2-chd5 control Fig. 8 from Bishop et al., 2015
trunk cell death increased occurrence, abnormal WT + MO2-chd5 control Fig. 7 from Bishop et al., 2015
splanchnocranium absent, abnormal WT + MO2-chd5 control Fig. 6 from Bishop et al., 2015
optic stalk fgf8a expression increased amount, abnormal WT + MO2-chd5 control Fig. 8 from Bishop et al., 2015
hindbrain pax6a expression decreased amount, abnormal WT + MO2-chd5 control Fig. 8 from Bishop et al., 2015
midbrain otx2b expression decreased amount, abnormal WT + MO2-chd5 control Fig. 8 from Bishop et al., 2015
head cell death increased occurrence, abnormal WT + MO2-chd5 control Fig. 7 from Bishop et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.