Morpholino
MO2-chd5
- ID
- ZDB-MRPHLNO-151208-6
- Name
- MO2-chd5
- Previous Names
-
- chd5MO1 (1)
- Target
- Sequence
-
5' - CGGGCATCTTTACCGCATAACAAGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-chd5
No data available
Phenotype
Phenotype resulting from MO2-chd5
1 - 5 of 12 Show all
Phenotype of all Fish created by or utilizing MO2-chd5
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
head decreased size, abnormal | WT + MO2-chd5 | control |
Fig. 4,
Fig. 5
from Bishop et al., 2015 |
diencephalon dorsal region fgf8a expression increased amount, abnormal | WT + MO2-chd5 | control |
Fig. 8
from Bishop et al., 2015 |
eye decreased size, abnormal | WT + MO2-chd5 | control |
Fig. 4,
Fig. 5
from Bishop et al., 2015 |
telencephalon fgf8a expression increased amount, abnormal | WT + MO2-chd5 | control |
Fig. 8
from Bishop et al., 2015 |
retina dopaminergic neuron th expression decreased amount, abnormal | WT + MO2-chd5 | control |
Fig. 9
from Bishop et al., 2015 |
1 - 5 of 12 Show all
Citations