Morpholino

MO5-kmt2d

ID
ZDB-MRPHLNO-151208-3
Name
MO5-kmt2d
Previous Names
None
Target
Sequence
5' - AATCATTTATGTTTACTAACCTGCA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-kmt2d
No data available
Phenotype
Phenotype resulting from MO5-kmt2d
Phenotype Fish Figures
brain cell population proliferation decreased occurrence, abnormal EKW + MO5-kmt2d Fig. 5 with image from Tsai et al., 2018
ceratohyal cartilage increased width, abnormal WT + MO5-kmt2d Fig. 6 from Bögershausen et al., 2015
ceratohyal cartilage kinked, abnormal WT + MO5-kmt2d Fig. 6 from Bögershausen et al., 2015
ceratohyal cartilage shortened, abnormal WT + MO5-kmt2d Fig. 6 from Bögershausen et al., 2015
ceratohyal cartilage chondrocyte disorganized, abnormal WT + MO5-kmt2d Fig. S4 from Bögershausen et al., 2015
chondrocyte filamentous actin position, abnormal WT + MO5-kmt2d Fig. S4 from Bögershausen et al., 2015
chondrocyte myosin II filament position, abnormal WT + MO5-kmt2d Fig. S4 from Bögershausen et al., 2015
convergent extension disrupted, abnormal WT + MO5-kmt2d Fig. 5 from Bögershausen et al., 2015
convergent extension involved in gastrulation disrupted, abnormal EKW + MO5-kmt2d Fig. 1Fig. 2 with imageFig. S5 from Tsai et al., 2018
head Ab5-map2k1/2 labeling increased amount, abnormal EKW + MO5-kmt2d Fig. 4 from Tsai et al., 2018
mandibular arch skeleton morphology, abnormal EKW + MO5-kmt2d Fig. 2 with image from Tsai et al., 2018
MAP kinase kinase activity increased rate, abnormal EKW + MO5-kmt2d Fig. 4 from Tsai et al., 2018
MAP kinase kinase activity process quality, abnormal WT + MO5-kmt2d Fig. 10 from Bögershausen et al., 2015
Meckel's cartilage decreased distance ceratohyal cartilage, abnormal EKW + MO5-kmt2d Fig. 2 with image from Tsai et al., 2018
Fig. 6 from Bögershausen et al., 2015
notochord increased width, abnormal WT + MO5-kmt2d Fig. 5 from Bögershausen et al., 2015
whole organism dead, abnormal EKW + MO5-kmt2d Fig. 1 from Tsai et al., 2018
whole organism anterior-posterior axis shortened, abnormal WT + MO5-kmt2d Fig. 5 from Bögershausen et al., 2015
Phenotype of all Fish created by or utilizing MO5-kmt2d
Phenotype Fish Conditions Figures
brain cell population proliferation decreased occurrence, abnormal EKW + MO5-kmt2d standard conditions Fig. 5 with image from Tsai et al., 2018
MAP kinase kinase activity process quality, ameliorated EKW + MO5-kmt2d chemical treatment by environment: B-Raf inhibitor Fig. 4 from Tsai et al., 2018
convergent extension involved in gastrulation disrupted, abnormal EKW + MO5-kmt2d standard conditions Fig. 1Fig. 2 with imageFig. S5 from Tsai et al., 2018
brain cell population proliferation process quality, ameliorated EKW + MO5-kmt2d chemical treatment by environment: B-Raf inhibitor Fig. 5 with image from Tsai et al., 2018
head Ab5-map2k1/2 labeling increased amount, abnormal EKW + MO5-kmt2d standard conditions Fig. 4 from Tsai et al., 2018
convergent extension involved in gastrulation disrupted, abnormal EKW + MO5-kmt2d chemical treatment by environment: dabrafenib Fig. S5 from Tsai et al., 2018
mandibular arch skeleton morphology, ameliorated EKW + MO5-kmt2d chemical treatment by environment: B-Raf inhibitor Fig. 2 with image from Tsai et al., 2018
Meckel's cartilage decreased distance ceratohyal cartilage, abnormal EKW + MO5-kmt2d standard conditions Fig. 2 with image from Tsai et al., 2018
convergent extension involved in gastrulation process quality, ameliorated EKW + MO5-kmt2d chemical treatment by environment: EC 2.7.12.2 (mitogen-activated protein kinase kinase) inhibitor Fig. 2 with image from Tsai et al., 2018
MAP kinase kinase activity increased rate, abnormal EKW + MO5-kmt2d standard conditions Fig. 4 from Tsai et al., 2018
Meckel's cartilage distance ceratohyal cartilage, ameliorated EKW + MO5-kmt2d chemical treatment by environment: B-Raf inhibitor Fig. 2 with image from Tsai et al., 2018
Meckel's cartilage distance ceratohyal cartilage, ameliorated EKW + MO5-kmt2d chemical treatment by environment: EC 2.7.12.2 (mitogen-activated protein kinase kinase) inhibitor Fig. 2 with image from Tsai et al., 2018
whole organism dead, abnormal EKW + MO5-kmt2d standard conditions Fig. 1 from Tsai et al., 2018
mandibular arch skeleton morphology, ameliorated EKW + MO5-kmt2d chemical treatment by environment: EC 2.7.12.2 (mitogen-activated protein kinase kinase) inhibitor Fig. 2 with image from Tsai et al., 2018
head Ab5-map2k1/2 labeling amount, ameliorated EKW + MO5-kmt2d chemical treatment by environment: B-Raf inhibitor Fig. 4 from Tsai et al., 2018
convergent extension involved in gastrulation process quality, ameliorated EKW + MO5-kmt2d chemical treatment by environment: B-Raf inhibitor Fig. 2 with image from Tsai et al., 2018
mandibular arch skeleton morphology, abnormal EKW + MO5-kmt2d standard conditions Fig. 2 with image from Tsai et al., 2018
convergent extension disrupted, abnormal WT + MO5-kmt2d standard conditions Fig. 5 from Bögershausen et al., 2015
ceratohyal cartilage increased width, abnormal WT + MO5-kmt2d standard conditions Fig. 6 from Bögershausen et al., 2015
chondrocyte myosin II filament position, abnormal WT + MO5-kmt2d standard conditions Fig. S4 from Bögershausen et al., 2015
Meckel's cartilage decreased distance ceratohyal cartilage, abnormal WT + MO5-kmt2d standard conditions Fig. 6 from Bögershausen et al., 2015
ceratohyal cartilage chondrocyte disorganized, abnormal WT + MO5-kmt2d standard conditions Fig. S4 from Bögershausen et al., 2015
notochord increased width, abnormal WT + MO5-kmt2d standard conditions Fig. 5 from Bögershausen et al., 2015
whole organism anterior-posterior axis shortened, abnormal WT + MO5-kmt2d standard conditions Fig. 5 from Bögershausen et al., 2015
chondrocyte filamentous actin position, abnormal WT + MO5-kmt2d standard conditions Fig. S4 from Bögershausen et al., 2015
ceratohyal cartilage kinked, abnormal WT + MO5-kmt2d standard conditions Fig. 6 from Bögershausen et al., 2015
ceratohyal cartilage shortened, abnormal WT + MO5-kmt2d standard conditions Fig. 6 from Bögershausen et al., 2015
MAP kinase kinase activity process quality, abnormal WT + MO5-kmt2d standard conditions Fig. 10 from Bögershausen et al., 2015
convergent extension disrupted, abnormal WT + MO1-rap1aa + MO1-rap1b + MO5-kmt2d standard conditions Fig. 7 from Bögershausen et al., 2015
Citations