Morpholino

MO5-kmt2d

ID
ZDB-MRPHLNO-151208-3
Name
MO5-kmt2d
Previous Names
None
Target
Sequence
5' - AATCATTTATGTTTACTAACCTGCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO5-kmt2d
Expressed Gene Anatomy Figures
rap1b Fig. 7 from Bögershausen et al., 2015
Phenotype
Phenotype resulting from MO5-kmt2d
Phenotype Fish Figures
brain cell population proliferation decreased occurrence, abnormal EKW + MO5-kmt2d Fig. 5 with image from Tsai et al., 2018
ceratohyal cartilage increased width, abnormal WT + MO5-kmt2d Fig. 6 from Bögershausen et al., 2015
ceratohyal cartilage kinked, abnormal WT + MO5-kmt2d Fig. 6 from Bögershausen et al., 2015
ceratohyal cartilage shortened, abnormal WT + MO5-kmt2d Fig. 6 from Bögershausen et al., 2015
ceratohyal cartilage chondrocyte disorganized, abnormal WT + MO5-kmt2d Fig. S4 from Bögershausen et al., 2015
chondrocyte filamentous actin position, abnormal WT + MO5-kmt2d Fig. S4 from Bögershausen et al., 2015
chondrocyte myosin II filament position, abnormal WT + MO5-kmt2d Fig. S4 from Bögershausen et al., 2015
convergent extension disrupted, abnormal WT + MO5-kmt2d Fig. 5 from Bögershausen et al., 2015
convergent extension involved in gastrulation disrupted, abnormal EKW + MO5-kmt2d Fig. 1,  Fig. 2 with image,  Fig. S5 from Tsai et al., 2018
head Ab5-map2k1/2 labeling increased amount, abnormal EKW + MO5-kmt2d Fig. 4 from Tsai et al., 2018
mandibular arch skeleton morphology, abnormal EKW + MO5-kmt2d Fig. 2 with image from Tsai et al., 2018
MAP kinase kinase activity increased rate, abnormal EKW + MO5-kmt2d Fig. 4 from Tsai et al., 2018
MAP kinase kinase activity process quality, abnormal WT + MO5-kmt2d Fig. 10 from Bögershausen et al., 2015
Meckel's cartilage decreased distance ceratohyal cartilage, abnormal EKW + MO5-kmt2d Fig. 2 with image from Tsai et al., 2018
Fig. 6 from Bögershausen et al., 2015
notochord increased width, abnormal WT + MO5-kmt2d Fig. 5 from Bögershausen et al., 2015
whole organism dead, abnormal EKW + MO5-kmt2d Fig. 1 from Tsai et al., 2018
whole organism anterior-posterior axis shortened, abnormal WT + MO5-kmt2d Fig. 5 from Bögershausen et al., 2015
Phenotype of all Fish created by or utilizing MO5-kmt2d
Phenotype Fish Conditions Figures
brain cell population proliferation decreased occurrence, abnormal EKW + MO5-kmt2d standard conditions Fig. 5 with image from Tsai et al., 2018
MAP kinase kinase activity process quality, ameliorated EKW + MO5-kmt2d chemical treatment by environment: B-Raf inhibitor Fig. 4 from Tsai et al., 2018
convergent extension involved in gastrulation disrupted, abnormal EKW + MO5-kmt2d standard conditions Fig. 1,  Fig. 2 with image,  Fig. S5 from Tsai et al., 2018
brain cell population proliferation process quality, ameliorated EKW + MO5-kmt2d chemical treatment by environment: B-Raf inhibitor Fig. 5 with image from Tsai et al., 2018
head Ab5-map2k1/2 labeling increased amount, abnormal EKW + MO5-kmt2d standard conditions Fig. 4 from Tsai et al., 2018
convergent extension involved in gastrulation disrupted, abnormal EKW + MO5-kmt2d chemical treatment by environment: dabrafenib Fig. S5 from Tsai et al., 2018
mandibular arch skeleton morphology, ameliorated EKW + MO5-kmt2d chemical treatment by environment: B-Raf inhibitor Fig. 2 with image from Tsai et al., 2018
Meckel's cartilage decreased distance ceratohyal cartilage, abnormal EKW + MO5-kmt2d standard conditions Fig. 2 with image from Tsai et al., 2018
convergent extension involved in gastrulation process quality, ameliorated EKW + MO5-kmt2d chemical treatment by environment: EC 2.7.12.2 (mitogen-activated protein kinase kinase) inhibitor Fig. 2 with image from Tsai et al., 2018
MAP kinase kinase activity increased rate, abnormal EKW + MO5-kmt2d standard conditions Fig. 4 from Tsai et al., 2018
Meckel's cartilage distance ceratohyal cartilage, ameliorated EKW + MO5-kmt2d chemical treatment by environment: B-Raf inhibitor Fig. 2 with image from Tsai et al., 2018
Meckel's cartilage distance ceratohyal cartilage, ameliorated EKW + MO5-kmt2d chemical treatment by environment: EC 2.7.12.2 (mitogen-activated protein kinase kinase) inhibitor Fig. 2 with image from Tsai et al., 2018
whole organism dead, abnormal EKW + MO5-kmt2d standard conditions Fig. 1 from Tsai et al., 2018
mandibular arch skeleton morphology, ameliorated EKW + MO5-kmt2d chemical treatment by environment: EC 2.7.12.2 (mitogen-activated protein kinase kinase) inhibitor Fig. 2 with image from Tsai et al., 2018
head Ab5-map2k1/2 labeling amount, ameliorated EKW + MO5-kmt2d chemical treatment by environment: B-Raf inhibitor Fig. 4 from Tsai et al., 2018
convergent extension involved in gastrulation process quality, ameliorated EKW + MO5-kmt2d chemical treatment by environment: B-Raf inhibitor Fig. 2 with image from Tsai et al., 2018
mandibular arch skeleton morphology, abnormal EKW + MO5-kmt2d standard conditions Fig. 2 with image from Tsai et al., 2018
convergent extension disrupted, abnormal WT + MO5-kmt2d standard conditions Fig. 5 from Bögershausen et al., 2015
ceratohyal cartilage increased width, abnormal WT + MO5-kmt2d standard conditions Fig. 6 from Bögershausen et al., 2015
chondrocyte myosin II filament position, abnormal WT + MO5-kmt2d standard conditions Fig. S4 from Bögershausen et al., 2015
Meckel's cartilage decreased distance ceratohyal cartilage, abnormal WT + MO5-kmt2d standard conditions Fig. 6 from Bögershausen et al., 2015
ceratohyal cartilage chondrocyte disorganized, abnormal WT + MO5-kmt2d standard conditions Fig. S4 from Bögershausen et al., 2015
notochord increased width, abnormal WT + MO5-kmt2d standard conditions Fig. 5 from Bögershausen et al., 2015
whole organism anterior-posterior axis shortened, abnormal WT + MO5-kmt2d standard conditions Fig. 5 from Bögershausen et al., 2015
chondrocyte filamentous actin position, abnormal WT + MO5-kmt2d standard conditions Fig. S4 from Bögershausen et al., 2015
ceratohyal cartilage kinked, abnormal WT + MO5-kmt2d standard conditions Fig. 6 from Bögershausen et al., 2015
ceratohyal cartilage shortened, abnormal WT + MO5-kmt2d standard conditions Fig. 6 from Bögershausen et al., 2015
MAP kinase kinase activity process quality, abnormal WT + MO5-kmt2d standard conditions Fig. 10 from Bögershausen et al., 2015
convergent extension disrupted, abnormal WT + MO1-rap1aa + MO1-rap1b + MO5-kmt2d standard conditions Fig. 7 from Bögershausen et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.