Morpholino
MO2-wnt9b
- ID
- ZDB-MRPHLNO-151125-3
- Name
- MO2-wnt9b
- Previous Names
- None
- Target
- Sequence
-
5' - ACCTGTAAGCCTAACGAAAACACAA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-wnt9b
No data available
Phenotype
Phenotype resulting from MO2-wnt9b
1 - 5 of 39 Show all
Phenotype of all Fish created by or utilizing MO2-wnt9b
1 - 5 of 49 Show all
Citations
- Pham, V.C., Rödel, C.J., Valentino, M., Malinverno, M., Paolini, A., Münch, J., Pasquier, C., Onyeogaziri, F.C., Lazovic, B., Girard, R., Koskimäki, J., Hußmann, M., Keith, B., Jachimowicz, D., Kohl, F., Hagelkruys, A., Penninger, J.M., Schulte-Merker, S., Awad, I.A., Hicks, R., Magnusson, P.U., Faurobert, E., Pagani, M., Abdelilah-Seyfried, S. (2024) Epigenetic regulation by polycomb repressive complex 1 promotes cerebral cavernous malformations. EMBO Molecular Medicine. 16(11):2827-2855
- Paolini, A., Sharipova, D., Lange, T., Abdelilah-Seyfried, S. (2023) Wnt9 directs zebrafish heart tube assembly via a combination of canonical and non-canonical pathway signaling. Development (Cambridge, England). 150(18):
- Jackson, H.W., Prakash, D., Litaker, M., Ferreira, T., Jezewski, P.A. (2015) Zebrafish Wnt9b Patterns the First Pharyngeal Arch into D-I-V Domains and Promotes Anterior-Medial Outgrowth. American Journal of Molecular Biology. 5(3):57-83
1 - 3 of 3
Show