Morpholino

MO2-wnt9b

ID
ZDB-MRPHLNO-151125-3
Name
MO2-wnt9b
Previous Names
None
Target
Sequence
5' - ACCTGTAAGCCTAACGAAAACACAA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-wnt9b
Expressed Gene Anatomy Figures
axin2 Fig. 3 from Jackson et al., 2015
dlx2a Fig. 3,  Fig. 5 with image from Jackson et al., 2015
edn1 Fig. 3,  Fig. 4 with image from Jackson et al., 2015
frzb Fig. 9 with image from Jackson et al., 2015
jag1b Fig. 4 with image from Jackson et al., 2015
msx1a Fig. 3 from Jackson et al., 2015
pitx2 Fig. 8 with image from Jackson et al., 2015
sox9a Fig. 7 with image from Jackson et al., 2015
tbx22 Fig. 3 from Jackson et al., 2015
wnt3a Fig. 3,  Fig. 6 with image from Jackson et al., 2015
wnt5b Fig. 3,  Fig. 6 with image,  Fig. 7 with image from Jackson et al., 2015
wnt9a Fig. 3 from Jackson et al., 2015
Phenotype
Phenotype resulting from MO2-wnt9b
Phenotype Fish Figures
brain wnt3a expression increased distribution, abnormal AB + MO2-wnt9b Fig. 6 with image from Jackson et al., 2015
ceratobranchial cartilage decreased size, abnormal AB + MO2-wnt9b Fig. 1 with image from Jackson et al., 2015
ceratohyal cartilage inverted, abnormal AB + MO2-wnt9b Fig. 1 with image from Jackson et al., 2015
cranium decreased length, abnormal AB + MO2-wnt9b Fig. 2 with image from Jackson et al., 2015
cranium anterior region decreased length, abnormal AB + MO2-wnt9b Fig. 1 with image from Jackson et al., 2015
ethmoid cartilage sox9a expression decreased amount, abnormal AB + MO2-wnt9b Fig. 7 with image from Jackson et al., 2015
ethmoid cartilage wnt5b expression decreased amount, abnormal AB + MO2-wnt9b Fig. 7 with image from Jackson et al., 2015
head anterior region flattened, abnormal AB + MO2-wnt9b Fig. 1 with image from Jackson et al., 2015
mandibular arch skeleton malformed, abnormal AB + MO2-wnt9b Fig. 1 with image from Jackson et al., 2015
Meckel's cartilage decreased size, abnormal AB + MO2-wnt9b Fig. 1 with image from Jackson et al., 2015
Meckel's cartilage malformed, abnormal AB + MO2-wnt9b Fig. 1 with image from Jackson et al., 2015
palatoquadrate arch pitx2 expression increased amount, abnormal AB + MO2-wnt9b Fig. 8 with image from Jackson et al., 2015
palatoquadrate arch pitx2 expression increased distribution, abnormal AB + MO2-wnt9b Fig. 8 with image from Jackson et al., 2015
palatoquadrate cartilage wnt5b expression decreased amount, abnormal AB + MO2-wnt9b Fig. 7 with image from Jackson et al., 2015
palatoquadrate cartilage decreased length, abnormal AB + MO2-wnt9b Fig. 2 with image from Jackson et al., 2015
palatoquadrate cartilage fused with Meckel's cartilage, abnormal AB + MO2-wnt9b Fig. 1 with image from Jackson et al., 2015
pectoral fin bud wnt5b expression increased amount, abnormal AB + MO2-wnt9b Fig. 6 with image from Jackson et al., 2015
pharyngeal arch edn1 expression decreased amount, abnormal AB + MO2-wnt9b Fig. 4 with image from Jackson et al., 2015
pharyngeal arch wnt5b expression decreased amount, abnormal AB + MO2-wnt9b Fig. 6 with image,  Fig. 7 with image from Jackson et al., 2015
pharyngeal arch jag1b expression increased distribution, abnormal AB + MO2-wnt9b Fig. 4 with image from Jackson et al., 2015
pharyngeal arch 1 sox9a expression decreased amount, abnormal AB + MO2-wnt9b Fig. 7 with image from Jackson et al., 2015
pharyngeal arch 1 dlx2a expression decreased amount, abnormal AB + MO2-wnt9b Fig. 5 with image from Jackson et al., 2015
pharyngeal arch 3-7 dlx2a expression decreased amount, abnormal AB + MO2-wnt9b Fig. 5 with image from Jackson et al., 2015
polster frzb expression increased amount, abnormal AB + MO2-wnt9b Fig. 9 with image from Jackson et al., 2015
polster frzb expression increased distribution, abnormal AB + MO2-wnt9b Fig. 9 with image from Jackson et al., 2015
tail bud wnt5b expression increased amount, abnormal AB + MO2-wnt9b Fig. 6 with image from Jackson et al., 2015
tail bud wnt5b expression increased distribution, abnormal AB + MO2-wnt9b Fig. 6 with image from Jackson et al., 2015
ventral mandibular arch pitx2 expression increased amount, abnormal AB + MO2-wnt9b Fig. 8 with image from Jackson et al., 2015
ventral mandibular arch pitx2 expression increased distribution, abnormal AB + MO2-wnt9b Fig. 8 with image from Jackson et al., 2015
whole organism msx1a expression decreased amount, abnormal AB + MO2-wnt9b Fig. 3 from Jackson et al., 2015
whole organism wnt5b expression decreased amount, abnormal AB + MO2-wnt9b Fig. 3 from Jackson et al., 2015
whole organism wnt9a expression decreased amount, abnormal AB + MO2-wnt9b Fig. 3 from Jackson et al., 2015
whole organism axin2 expression decreased amount, abnormal AB + MO2-wnt9b Fig. 3 from Jackson et al., 2015
whole organism tbx22 expression decreased amount, abnormal AB + MO2-wnt9b Fig. 3 from Jackson et al., 2015
whole organism wnt3a expression decreased amount, abnormal AB + MO2-wnt9b Fig. 3 from Jackson et al., 2015
whole organism dlx2a expression decreased amount, abnormal AB + MO2-wnt9b Fig. 3 from Jackson et al., 2015
whole organism edn1 expression decreased amount, abnormal AB + MO2-wnt9b Fig. 3 from Jackson et al., 2015
whole organism has fewer parts of type ceratobranchial cartilage, abnormal AB + MO2-wnt9b Fig. 1 with image from Jackson et al., 2015
whole organism lacks all parts of type swim bladder, abnormal AB + MO2-wnt9b Fig. 1 with image from Jackson et al., 2015
Phenotype of all Fish created by or utilizing MO2-wnt9b
Phenotype Fish Conditions Figures
palatoquadrate arch pitx2 expression increased distribution, abnormal AB + MO2-wnt9b standard conditions Fig. 8 with image from Jackson et al., 2015
pharyngeal arch edn1 expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 4 with image from Jackson et al., 2015
head anterior region flattened, abnormal AB + MO2-wnt9b standard conditions Fig. 1 with image from Jackson et al., 2015
whole organism wnt3a expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 3 from Jackson et al., 2015
pectoral fin bud wnt5b expression increased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 6 with image from Jackson et al., 2015
pharyngeal arch wnt5b expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 6 with image,  Fig. 7 with image from Jackson et al., 2015
tail bud wnt5b expression increased distribution, abnormal AB + MO2-wnt9b standard conditions Fig. 6 with image from Jackson et al., 2015
palatoquadrate cartilage wnt5b expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 7 with image from Jackson et al., 2015
whole organism lacks all parts of type swim bladder, abnormal AB + MO2-wnt9b standard conditions Fig. 1 with image from Jackson et al., 2015
whole organism wnt9a expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 3 from Jackson et al., 2015
ceratobranchial cartilage decreased size, abnormal AB + MO2-wnt9b standard conditions Fig. 1 with image from Jackson et al., 2015
cranium anterior region decreased length, abnormal AB + MO2-wnt9b standard conditions Fig. 1 with image from Jackson et al., 2015
palatoquadrate cartilage decreased length, abnormal AB + MO2-wnt9b standard conditions Fig. 2 with image from Jackson et al., 2015
cranium decreased length, abnormal AB + MO2-wnt9b standard conditions Fig. 2 with image from Jackson et al., 2015
ceratohyal cartilage inverted, abnormal AB + MO2-wnt9b standard conditions Fig. 1 with image from Jackson et al., 2015
pharyngeal arch jag1b expression increased distribution, abnormal AB + MO2-wnt9b standard conditions Fig. 4 with image from Jackson et al., 2015
ethmoid cartilage sox9a expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 7 with image from Jackson et al., 2015
pharyngeal arch 3-7 dlx2a expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 5 with image from Jackson et al., 2015
whole organism axin2 expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 3 from Jackson et al., 2015
palatoquadrate cartilage fused with Meckel's cartilage, abnormal AB + MO2-wnt9b standard conditions Fig. 1 with image from Jackson et al., 2015
whole organism has fewer parts of type ceratobranchial cartilage, abnormal AB + MO2-wnt9b standard conditions Fig. 1 with image from Jackson et al., 2015
pharyngeal arch 1 dlx2a expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 5 with image from Jackson et al., 2015
polster frzb expression increased distribution, abnormal AB + MO2-wnt9b standard conditions Fig. 9 with image from Jackson et al., 2015
whole organism wnt5b expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 3 from Jackson et al., 2015
whole organism msx1a expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 3 from Jackson et al., 2015
polster frzb expression increased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 9 with image from Jackson et al., 2015
mandibular arch skeleton malformed, abnormal AB + MO2-wnt9b standard conditions Fig. 1 with image from Jackson et al., 2015
tail bud wnt5b expression increased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 6 with image from Jackson et al., 2015
palatoquadrate arch pitx2 expression increased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 8 with image from Jackson et al., 2015
ventral mandibular arch pitx2 expression increased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 8 with image from Jackson et al., 2015
ventral mandibular arch pitx2 expression increased distribution, abnormal AB + MO2-wnt9b standard conditions Fig. 8 with image from Jackson et al., 2015
ethmoid cartilage wnt5b expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 7 with image from Jackson et al., 2015
Meckel's cartilage malformed, abnormal AB + MO2-wnt9b standard conditions Fig. 1 with image from Jackson et al., 2015
pharyngeal arch 1 sox9a expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 7 with image from Jackson et al., 2015
whole organism edn1 expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 3 from Jackson et al., 2015
whole organism tbx22 expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 3 from Jackson et al., 2015
brain wnt3a expression increased distribution, abnormal AB + MO2-wnt9b standard conditions Fig. 6 with image from Jackson et al., 2015
whole organism dlx2a expression decreased amount, abnormal AB + MO2-wnt9b standard conditions Fig. 3 from Jackson et al., 2015
Meckel's cartilage decreased size, abnormal AB + MO2-wnt9b standard conditions Fig. 1 with image from Jackson et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.