Morpholino

MO1-rnasel2, rnasel5

ID
ZDB-MRPHLNO-151123-3
Name
MO1-rnasel2, rnasel5
Previous Names
  • MO1-rnasel2
Targets
Sequence
5' - CGGCAGACTGAAGAATCTCCATGAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rnasel2, rnasel5
No data available
Phenotype
Phenotype resulting from MO1-rnasel2, rnasel5
No data available
Phenotype of all Fish created by or utilizing MO1-rnasel2, rnasel5
Phenotype Fish Conditions Figures
whole organism tp53 expression increased amount, abnormal AB + MO1-rnasel2, rnasel5 standard conditions Fig. 5 from Zhai et al., 2015
yolk syncytial layer apoptotic DNA fragmentation increased occurrence, abnormal AB + MO1-rnasel2, rnasel5 standard conditions Fig. 4 from Zhai et al., 2015
hatching delayed, abnormal AB + MO1-rnasel2, rnasel5 standard conditions Fig. 2 from Zhai et al., 2015
whole organism baxa expression increased amount, abnormal AB + MO1-rnasel2, rnasel5 standard conditions Fig. 5 from Zhai et al., 2015
extension hypotrophic, abnormal AB + MO1-rnasel2, rnasel5 standard conditions Fig. 3Fig. 5 from Zhai et al., 2015
hatching disrupted, abnormal AB + MO1-rnasel2, rnasel5 standard conditions Fig. 2 from Zhai et al., 2015
whole organism cdkn1a expression increased amount, abnormal AB + MO1-rnasel2, rnasel5 standard conditions Fig. 5 from Zhai et al., 2015
whole organism dead, abnormal AB + MO1-rnasel2, rnasel5 standard conditions Fig. 2 from Zhai et al., 2015
extension morphology, abnormal AB + MO1-rnasel2, rnasel5 standard conditions Fig. 3Fig. 5 from Zhai et al., 2015
hatching delayed, ameliorated AB + MO1-rnasel2, rnasel5 + MO4-tp53 standard conditions text only from Zhai et al., 2015
extension decreased area, ameliorated AB + MO1-rnasel2, rnasel5 + MO4-tp53 standard conditions Fig. 5 from Zhai et al., 2015
extension morphology, ameliorated AB + MO1-rnasel2, rnasel5 + MO4-tp53 standard conditions Fig. 5 from Zhai et al., 2015
hatching delayed, ameliorated tp53zdf1/zdf1 + MO1-rnasel2, rnasel5 standard conditions text only from Zhai et al., 2015
extension morphology, ameliorated tp53zdf1/zdf1 + MO1-rnasel2, rnasel5 standard conditions Fig. 5 from Zhai et al., 2015
extension decreased area, ameliorated tp53zdf1/zdf1 + MO1-rnasel2, rnasel5 standard conditions Fig. 5 from Zhai et al., 2015
sprouting angiogenesis disrupted, abnormal y1Tg + MO1-rnasel2, rnasel5 standard conditions Fig. 2 from Zhai et al., 2015
intersegmental vessel immature, abnormal y1Tg + MO1-rnasel2, rnasel5 standard conditions Fig. 2 from Zhai et al., 2015
Citations