ZFIN ID: ZDB-MRPHLNO-151118-1
Morpholino Name: MO1-hoxb7a
Target: hoxb7a (1)
Sequence:
5' - AGCACCTGTGAAAAGCGCAGAATGA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-hoxb7a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-hoxb7a
Expressed Gene Anatomy Figures
pax2a Fig. S5 from Rochtus et al., 2015
PHENOTYPE
Phenotype resulting from MO1-hoxb7a
Phenotype of all Fish created by or utilizing MO1-hoxb7a
Genome Resources:
CITATIONS (1)