Morpholino

MO1-egfl6

ID

ZDB-MRPHLNO-151116-4

Name

MO1-egfl6

Previous Names

None

Target

Sequence

5' - TGATCCACGTCAGATGTTTCATGGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-egfl6

Expressed Gene	Anatomy	Figures
notch2	notochord	Fig. 3 from Wang et al., 2015
rag1	thymus	Figure 3. from Jin et al., 2021

Phenotype

Phenotype resulting from MO1-egfl6

Phenotype	Fish	Figures
dorsal longitudinal anastomotic vessel blood vessel morphogenesis decreased occurrence, abnormal	s843Tg + MO1-egfl6	Fig. 3 from Wang et al., 2016
intersegmental vessel decreased length, abnormal	s843Tg + MO1-egfl6	Fig. 3 , Fig. 7 from Wang et al., 2016
intersegmental vessel endothelial cell decreased amount, abnormal	y7Tg + MO1-egfl6	Fig. 7 from Wang et al., 2016
notochord deformed, abnormal	AB + MO1-egfl6	Fig. 3 from Wang et al., 2015
notochord development disrupted, abnormal	AB + MO1-egfl6	Fig. 3 from Wang et al., 2015
sprouting angiogenesis decreased occurrence, abnormal	s843Tg + MO1-egfl6	Fig. 3 from Wang et al., 2016
trunk curved, abnormal	AB + MO1-egfl6	Fig. 3 from Wang et al., 2015

Phenotype of all Fish created by or utilizing MO1-egfl6

Phenotype	Fish	Conditions	Figures
notochord deformed, abnormal	AB + MO1-egfl6	standard conditions	Fig. 3 from Wang et al., 2015
trunk curved, abnormal	AB + MO1-egfl6	standard conditions	Fig. 3 from Wang et al., 2015
notochord development disrupted, abnormal	AB + MO1-egfl6	standard conditions	Fig. 3 from Wang et al., 2015
intersegmental vessel decreased length, ameliorated	s843Tg + MO1-egfl6	chemical treatment by environment: DAPT	Fig. 7 from Wang et al., 2016
sprouting angiogenesis decreased occurrence, abnormal	s843Tg + MO1-egfl6	standard conditions	Fig. 3 from Wang et al., 2016
dorsal longitudinal anastomotic vessel blood vessel morphogenesis decreased occurrence, abnormal	s843Tg + MO1-egfl6	standard conditions	Fig. 3 from Wang et al., 2016
intersegmental vessel decreased length, abnormal	s843Tg + MO1-egfl6	standard conditions	Fig. 3 , Fig. 7 from Wang et al., 2016
intersegmental vessel endothelial cell decreased amount, abnormal	y7Tg + MO1-egfl6	standard conditions	Fig. 7 from Wang et al., 2016
intersegmental vessel endothelial cell amount, ameliorated	y7Tg + MO1-egfl6	chemical treatment by environment: DAPT	Fig. 7 from Wang et al., 2016
intersegmental vessel decreased length, ameliorated	s843Tg + MO1-egfl6 + MO3-dll4	standard conditions	Fig. 7 from Wang et al., 2016
intersegmental vessel endothelial cell amount, ameliorated	y7Tg + MO1-egfl6 + MO3-dll4	standard conditions	Fig. 7 from Wang et al., 2016

Citations