Morpholino

MO3-lrp5

ID
ZDB-MRPHLNO-151110-1
Name
MO3-lrp5
Previous Names
  • lrp5MoUp (1)
Target
Sequence
5' - AGCTGCTCTTACAGTTTGTAGAGAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-lrp5
No data available
Phenotype
Phenotype resulting from MO3-lrp5
No data available
Phenotype of all Fish created by or utilizing MO3-lrp5
Phenotype Fish Conditions Figures
hindbrain ccnd1 expression increased distribution, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 6 with image from Willems et al., 2015
cranial neural crest cell crestin expression decreased distribution, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 4 with image from Willems et al., 2015
cranial neural crest cell mislocalised, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 4 with image from Willems et al., 2015
cell proliferation in hindbrain decreased occurrence, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 6 with image from Willems et al., 2015
ceratobranchial 2 cartilage aplastic, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 2 with image from Willems et al., 2015
cranium malformed, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 2 with image from Willems et al., 2015
cranial neural crest cell canonical Wnt signaling pathway decreased process quality, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 3 with image from Willems et al., 2015
cranial neural crest cell lef1 expression decreased distribution, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 3 with image from Willems et al., 2015
cranium lacks parts or has fewer parts of type ceratobranchial cartilage, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 2 with image from Willems et al., 2015
ceratobranchial 4 cartilage aplastic, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 2 with image from Willems et al., 2015
rhombomere 6 dlx2a expression mislocalised, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 4 with image from Willems et al., 2015
ceratobranchial 1 cartilage aplastic, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 2 with image from Willems et al., 2015
cranial neural crest cell dlx2a expression decreased distribution, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 4 with image from Willems et al., 2015
embryonic cranial skeleton morphogenesis process quality, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 2 with image from Willems et al., 2015
ceratobranchial 3 cartilage aplastic, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 2 with image from Willems et al., 2015
rhombomere 6 crestin expression mislocalised, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 4 with image from Willems et al., 2015
cranial neural crest cell neural crest cell migration decreased process quality, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 4 with image from Willems et al., 2015
fourth ventricle swollen, abnormal WT + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 2 with image from Willems et al., 2015
ceratobranchial 2 cartilage aplastic, abnormal WT + MO3-lrp5 + MO4-lrp5 + MO4-tp53 standard conditions Fig. 2 with image from Willems et al., 2015
cranium malformed, abnormal WT + MO3-lrp5 + MO4-lrp5 + MO4-tp53 standard conditions Fig. 2 with image from Willems et al., 2015
ceratobranchial 4 cartilage aplastic, abnormal WT + MO3-lrp5 + MO4-lrp5 + MO4-tp53 standard conditions Fig. 2 with image from Willems et al., 2015
ceratobranchial 1 cartilage aplastic, abnormal WT + MO3-lrp5 + MO4-lrp5 + MO4-tp53 standard conditions Fig. 2 with image from Willems et al., 2015
ceratobranchial 3 cartilage aplastic, abnormal WT + MO3-lrp5 + MO4-lrp5 + MO4-tp53 standard conditions Fig. 2 with image from Willems et al., 2015
embryonic cranial skeleton morphogenesis process quality, abnormal WT + MO3-lrp5 + MO4-lrp5 + MO4-tp53 standard conditions Fig. 2 with image from Willems et al., 2015
cranial neural crest cell decreased amount, abnormal ba2Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 4 with image from Willems et al., 2015
cranial neural crest cell mislocalised, abnormal ba2Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 4 with image from Willems et al., 2015
cranial neural crest cell neural crest cell migration decreased process quality, abnormal ba2Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 4 with image from Willems et al., 2015
cranial neural crest cell EGFP expression decreased distribution, abnormal ba2Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 4 with image from Willems et al., 2015
rhombomere 6 EGFP expression mislocalised, abnormal ba2Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 4 with image from Willems et al., 2015
hindbrain canonical Wnt signaling pathway decreased process quality, abnormal w25Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 3 with image from Willems et al., 2015
tail bud GFP expression decreased distribution, abnormal w25Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 3 with image from Willems et al., 2015
midbrain hindbrain boundary GFP expression decreased distribution, abnormal w25Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 3 with image from Willems et al., 2015
hindbrain GFP expression decreased distribution, abnormal w25Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 3 with image from Willems et al., 2015
ceratobranchial 1 cartilage hypoplastic, abnormal y1Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 7 with image from Willems et al., 2015
ceratobranchial 2 cartilage aplastic, abnormal y1Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 7 with image from Willems et al., 2015
cranium malformed, abnormal y1Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 7 with image from Willems et al., 2015
ceratobranchial 4 cartilage aplastic, abnormal y1Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 7 with image from Willems et al., 2015
embryonic viscerocranium morphogenesis process quality, abnormal y1Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 7 with image from Willems et al., 2015
ceratobranchial 3 cartilage aplastic, abnormal y1Tg + MO3-lrp5 + MO4-lrp5 standard conditions Fig. 7 with image from Willems et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.