Morpholino

MO3-wnt5a

ID

ZDB-MRPHLNO-151028-2

Name

MO3-wnt5a

Previous Names

None

Target

Sequence

5' - GTGTTTTTGCGGCGTACATACCGAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-wnt5a

No data available

Phenotype

Phenotype resulting from MO3-wnt5a

Phenotype	Fish	Figures
eye decreased size, abnormal	WT + MO3-wnt5a	Fig. 2 from Huang et al., 2014
pericardium edematous, abnormal	li1Tg + MO3-wnt5a	Fig. 1 from Huang et al., 2014
perichondrium edematous, abnormal	WT + MO3-wnt5a	Fig. 2 from Huang et al., 2014
post-vent region curved ventral, abnormal	WT + MO3-wnt5a	Fig. 2 from Huang et al., 2014 Fig. 1 from Huang et al., 2014
post-vent region increased curvature, abnormal	li1Tg + MO3-wnt5a	Fig. 1 from Huang et al., 2014
pronephric duct cystic, abnormal	li1Tg + MO3-wnt5a	Fig. 3 from Huang et al., 2014
pronephric glomerulus cystic, abnormal	li1Tg + MO3-wnt5a	Fig. 2, Fig. 3 from Huang et al., 2014
whole organism anatomical axis decreased length, abnormal	WT + MO3-wnt5a	Fig. 2 from Huang et al., 2014
whole organism anatomical axis morphology, abnormal	WT + MO3-wnt5a	Fig. 2 from Huang et al., 2014

Phenotype of all Fish created by or utilizing MO3-wnt5a

Phenotype	Fish	Conditions	Figures
eye decreased size, abnormal	WT + MO3-wnt5a	standard conditions	Fig. 2 from Huang et al., 2014
perichondrium edematous, abnormal	WT + MO3-wnt5a	standard conditions	Fig. 2 from Huang et al., 2014
post-vent region curved ventral, abnormal	WT + MO3-wnt5a	standard conditions	Fig. 2 from Huang et al., 2014
whole organism anatomical axis morphology, abnormal	WT + MO3-wnt5a	standard conditions	Fig. 2 from Huang et al., 2014
whole organism anatomical axis decreased length, abnormal	WT + MO3-wnt5a	standard conditions	Fig. 2 from Huang et al., 2014
pronephric duct cystic, abnormal	li1Tg + MO3-wnt5a	control	Fig. 3 from Huang et al., 2014
post-vent region increased curvature, abnormal	li1Tg + MO3-wnt5a	control	Fig. 1 from Huang et al., 2014
post-vent region curved ventral, abnormal	li1Tg + MO3-wnt5a	control	Fig. 1 from Huang et al., 2014
pronephric glomerulus cystic, abnormal	li1Tg + MO3-wnt5a	control	Fig. 2, Fig. 3 from Huang et al., 2014
pericardium edematous, abnormal	li1Tg + MO3-wnt5a	control	Fig. 1 from Huang et al., 2014

Citations