Morpholino

MO1-tek

ID
ZDB-MRPHLNO-151026-1
Name
MO1-tek
Previous Names
  • tie2 MO (1)
Target
Sequence
5' - AGTCCAGCAGACACATGATGATCCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tek
Expressed Gene Anatomy Figures
ephb4a Fig. S2 from Li et al., 2014
flt4 Fig. S2 from Li et al., 2014
notch3 Fig. S2 from Li et al., 2014
tbx20 Fig. S2 from Li et al., 2014
Phenotype
Phenotype resulting from MO1-tek
Phenotype Fish Figures
angiogenesis delayed, abnormal tekbns401/+ + MO1-tek Fig. 3 with image from Jiang et al., 2020
blood vessel morphogenesis disrupted, abnormal y1Tg + MO1-tek Fig. S3 from Li et al., 2014
caudal vein morphology, abnormal y1Tg + MO1-tek Fig. S3 from Li et al., 2014
common cardinal vein morphology, abnormal y1Tg + MO1-tek Fig. S3 from Li et al., 2014
dorsal longitudinal anastomotic vessel broken, abnormal y1Tg + MO1-tek Fig. S3 from Li et al., 2014
head central artery decreased amount, abnormal s843Tg/+ + MO1-tek Fig. 2 with image from Jiang et al., 2020
head central artery EGFP expression decreased distribution, abnormal s843Tg/+ + MO1-tek Fig. 2 with image from Jiang et al., 2020
head common cardinal vein decreased amount, abnormal s843Tg/+ + MO1-tek Fig. 2 with image from Jiang et al., 2020
head common cardinal vein EGFP expression decreased distribution, abnormal s843Tg/+ + MO1-tek Fig. 2 with image from Jiang et al., 2020
intersegmental vessel aplastic, abnormal y1Tg + MO1-tek Fig. 1 from Li et al., 2014
intersegmental vessel decreased amount, abnormal s896Tg; y7Tg + MO1-tek Fig. 1,  Fig. 2 from Li et al., 2014
intersegmental vessel morphology, abnormal s843Tg/+ + MO1-tek Fig. 2 with image,  Fig. 3 with image from Jiang et al., 2020
Fig. 2 from Li et al., 2014
intersegmental vessel truncated, abnormal y1Tg + MO1-tek Fig. 1,  Fig. 2 from Li et al., 2014
intersegmental vessel endothelial cell EGFP expression decreased distribution, abnormal s843Tg/+ + MO1-tek Fig. 2 with image from Jiang et al., 2020
parachordal vessel aplastic, abnormal y1Tg + MO1-tek Fig. S3 from Li et al., 2014
sprouting angiogenesis disrupted, abnormal y1Tg + MO1-tek Fig. 1,  Fig. 2 from Li et al., 2014
subintestinal vein morphology, abnormal y1Tg + MO1-tek Fig. S3 from Li et al., 2014
trunk vasculature endothelial cell decreased amount, abnormal s843Tg/+ + MO1-tek Fig. 2 with image from Jiang et al., 2020
Phenotype of all Fish created by or utilizing MO1-tek
Phenotype Fish Conditions Figures
head central artery EGFP expression decreased distribution, abnormal s843Tg/+ + MO1-tek standard conditions Fig. 2 with image from Jiang et al., 2020
intersegmental vessel morphology, abnormal s843Tg/+ + MO1-tek standard conditions Fig. 2 with image from Jiang et al., 2020
intersegmental vessel endothelial cell EGFP expression decreased distribution, abnormal s843Tg/+ + MO1-tek standard conditions Fig. 2 with image from Jiang et al., 2020
head common cardinal vein decreased amount, abnormal s843Tg/+ + MO1-tek standard conditions Fig. 2 with image from Jiang et al., 2020
trunk vasculature endothelial cell decreased amount, abnormal s843Tg/+ + MO1-tek standard conditions Fig. 2 with image from Jiang et al., 2020
head central artery decreased amount, abnormal s843Tg/+ + MO1-tek standard conditions Fig. 2 with image from Jiang et al., 2020
head common cardinal vein EGFP expression decreased distribution, abnormal s843Tg/+ + MO1-tek standard conditions Fig. 2 with image from Jiang et al., 2020
intersegmental vessel endothelial cell EGFP expression decreased distribution, abnormal s843Tg/+ + MO1-tek + MO2-tek standard conditions Fig. 2 with image from Jiang et al., 2020
head central artery EGFP expression decreased distribution, abnormal s843Tg/+ + MO1-tek + MO2-tek standard conditions Fig. 2 with image from Jiang et al., 2020
head common cardinal vein EGFP expression decreased distribution, abnormal s843Tg/+ + MO1-tek + MO2-tek standard conditions Fig. 2 with image from Jiang et al., 2020
intersegmental vessel morphology, abnormal s843Tg/+ + MO1-tek + MO2-tek standard conditions Fig. 2 with image from Jiang et al., 2020
trunk vasculature endothelial cell decreased amount, abnormal s843Tg/+ + MO1-tek + MO2-tek standard conditions Fig. 2 with image from Jiang et al., 2020
head common cardinal vein decreased amount, abnormal s843Tg/+ + MO1-tek + MO2-tek standard conditions Fig. 2 with image from Jiang et al., 2020
head central artery decreased amount, abnormal s843Tg/+ + MO1-tek + MO2-tek standard conditions Fig. 2 with image from Jiang et al., 2020
angiogenesis delayed, abnormal tekbns401/+ + MO1-tek standard conditions Fig. 3 with image from Jiang et al., 2020
intersegmental vessel morphology, abnormal y1Tg/+ + MO1-tek standard conditions Fig. 3 with image from Jiang et al., 2020
sprouting angiogenesis disrupted, abnormal y1Tg + MO1-tek standard conditions Fig. 1 from Li et al., 2014
common cardinal vein morphology, abnormal y1Tg + MO1-tek standard conditions Fig. S3 from Li et al., 2014
parachordal vessel aplastic, abnormal y1Tg + MO1-tek standard conditions Fig. S3 from Li et al., 2014
intersegmental vessel truncated, abnormal y1Tg + MO1-tek standard conditions Fig. 1 from Li et al., 2014
intersegmental vessel decreased amount, abnormal y1Tg + MO1-tek standard conditions Fig. 1 from Li et al., 2014
blood vessel morphogenesis disrupted, abnormal y1Tg + MO1-tek standard conditions Fig. S3 from Li et al., 2014
intersegmental vessel aplastic, abnormal y1Tg + MO1-tek standard conditions Fig. 1 from Li et al., 2014
caudal vein morphology, abnormal y1Tg + MO1-tek standard conditions Fig. S3 from Li et al., 2014
dorsal longitudinal anastomotic vessel broken, abnormal y1Tg + MO1-tek standard conditions Fig. S3 from Li et al., 2014
subintestinal vein morphology, abnormal y1Tg + MO1-tek standard conditions Fig. S3 from Li et al., 2014
intersegmental vessel morphology, abnormal s896Tg; y7Tg + MO1-tek standard conditions Fig. 2 from Li et al., 2014
sprouting angiogenesis disrupted, abnormal s896Tg; y7Tg + MO1-tek standard conditions Fig. 2 from Li et al., 2014
intersegmental vessel decreased amount, abnormal s896Tg; y7Tg + MO1-tek standard conditions Fig. 2 from Li et al., 2014
intersegmental vessel truncated, abnormal s896Tg; y7Tg + MO1-tek standard conditions Fig. 2 from Li et al., 2014
intersegmental vessel morphology, abnormal tekbns401/+; y1Tg/+ + MO1-tek standard conditions Fig. 3 with image from Jiang et al., 2020
intersegmental vessel morphology, abnormal tekbns401/bns401; y1Tg/+ + MO1-tek standard conditions Fig. 3 with image from Jiang et al., 2020
intersegmental vessel morphology, abnormal y1Tg + MO1-tek + MO1-vegfaa standard conditions Fig. 4 from Li et al., 2014
intersegmental vessel truncated, abnormal y1Tg + MO1-tek + MO1-vegfaa standard conditions Fig. 4 from Li et al., 2014
sprouting angiogenesis disrupted, abnormal y1Tg + MO1-tek + MO1-vegfaa standard conditions Fig. 4 from Li et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.