Morpholino

MO1-tek

ID
ZDB-MRPHLNO-151026-1
Name
MO1-tek
Previous Names
  • tie2 MO (1)
Target
Sequence
5' - AGTCCAGCAGACACATGATGATCCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tek
No data available
Phenotype
Phenotype resulting from MO1-tek
Phenotype Fish Figures
angiogenesis delayed, abnormal tekbns401/+ + MO1-tek Fig. 3 with image from Jiang et al., 2020
blood vessel morphogenesis disrupted, abnormal y1Tg + MO1-tek Fig. S3 from Li et al., 2014
caudal vein morphology, abnormal y1Tg + MO1-tek Fig. S3 from Li et al., 2014
common cardinal vein morphology, abnormal y1Tg + MO1-tek Fig. S3 from Li et al., 2014
dorsal longitudinal anastomotic vessel broken, abnormal y1Tg + MO1-tek Fig. S3 from Li et al., 2014
head central artery decreased amount, abnormal s843Tg/+ + MO1-tek Fig. 2 with image from Jiang et al., 2020
head central artery EGFP expression decreased distribution, abnormal s843Tg/+ + MO1-tek Fig. 2 with image from Jiang et al., 2020
head common cardinal vein decreased amount, abnormal s843Tg/+ + MO1-tek Fig. 2 with image from Jiang et al., 2020
head common cardinal vein EGFP expression decreased distribution, abnormal s843Tg/+ + MO1-tek Fig. 2 with image from Jiang et al., 2020
intersegmental vessel aplastic, abnormal y1Tg + MO1-tek Fig. 1 from Li et al., 2014
intersegmental vessel decreased amount, abnormal s896Tg; y7Tg + MO1-tek Fig. 1Fig. 2 from Li et al., 2014
intersegmental vessel morphology, abnormal tekbns401/+; y1Tg/+ + MO1-tek Fig. 2 with imageFig. 3 with image from Jiang et al., 2020
Fig. 2 from Li et al., 2014
intersegmental vessel truncated, abnormal y1Tg + MO1-tek Fig. 1Fig. 2 from Li et al., 2014
intersegmental vessel endothelial cell EGFP expression decreased distribution, abnormal s843Tg/+ + MO1-tek Fig. 2 with image from Jiang et al., 2020
parachordal vessel aplastic, abnormal y1Tg + MO1-tek Fig. S3 from Li et al., 2014
sprouting angiogenesis disrupted, abnormal y1Tg + MO1-tek Fig. 1Fig. 2 from Li et al., 2014
subintestinal vein morphology, abnormal y1Tg + MO1-tek Fig. S3 from Li et al., 2014
trunk vasculature endothelial cell decreased amount, abnormal s843Tg/+ + MO1-tek Fig. 2 with image from Jiang et al., 2020
Phenotype of all Fish created by or utilizing MO1-tek
Phenotype Fish Conditions Figures
head central artery EGFP expression decreased distribution, abnormal s843Tg/+ + MO1-tek standard conditions Fig. 2 with image from Jiang et al., 2020
intersegmental vessel morphology, abnormal s843Tg/+ + MO1-tek standard conditions Fig. 2 with image from Jiang et al., 2020
intersegmental vessel endothelial cell EGFP expression decreased distribution, abnormal s843Tg/+ + MO1-tek standard conditions Fig. 2 with image from Jiang et al., 2020
head common cardinal vein decreased amount, abnormal s843Tg/+ + MO1-tek standard conditions Fig. 2 with image from Jiang et al., 2020
trunk vasculature endothelial cell decreased amount, abnormal s843Tg/+ + MO1-tek standard conditions Fig. 2 with image from Jiang et al., 2020
head central artery decreased amount, abnormal s843Tg/+ + MO1-tek standard conditions Fig. 2 with image from Jiang et al., 2020
head common cardinal vein EGFP expression decreased distribution, abnormal s843Tg/+ + MO1-tek standard conditions Fig. 2 with image from Jiang et al., 2020
intersegmental vessel endothelial cell EGFP expression decreased distribution, abnormal s843Tg/+ + MO1-tek + MO2-tek standard conditions Fig. 2 with image from Jiang et al., 2020
head central artery EGFP expression decreased distribution, abnormal s843Tg/+ + MO1-tek + MO2-tek standard conditions Fig. 2 with image from Jiang et al., 2020
head common cardinal vein EGFP expression decreased distribution, abnormal s843Tg/+ + MO1-tek + MO2-tek standard conditions Fig. 2 with image from Jiang et al., 2020
intersegmental vessel morphology, abnormal s843Tg/+ + MO1-tek + MO2-tek standard conditions Fig. 2 with image from Jiang et al., 2020
trunk vasculature endothelial cell decreased amount, abnormal s843Tg/+ + MO1-tek + MO2-tek standard conditions Fig. 2 with image from Jiang et al., 2020
head common cardinal vein decreased amount, abnormal s843Tg/+ + MO1-tek + MO2-tek standard conditions Fig. 2 with image from Jiang et al., 2020
head central artery decreased amount, abnormal s843Tg/+ + MO1-tek + MO2-tek standard conditions Fig. 2 with image from Jiang et al., 2020
angiogenesis delayed, abnormal tekbns401/+ + MO1-tek standard conditions Fig. 3 with image from Jiang et al., 2020
intersegmental vessel morphology, abnormal y1Tg/+ + MO1-tek standard conditions Fig. 3 with image from Jiang et al., 2020
sprouting angiogenesis disrupted, abnormal y1Tg + MO1-tek standard conditions Fig. 1 from Li et al., 2014
common cardinal vein morphology, abnormal y1Tg + MO1-tek standard conditions Fig. S3 from Li et al., 2014
parachordal vessel aplastic, abnormal y1Tg + MO1-tek standard conditions Fig. S3 from Li et al., 2014
intersegmental vessel truncated, abnormal y1Tg + MO1-tek standard conditions Fig. 1 from Li et al., 2014
intersegmental vessel decreased amount, abnormal y1Tg + MO1-tek standard conditions Fig. 1 from Li et al., 2014
blood vessel morphogenesis disrupted, abnormal y1Tg + MO1-tek standard conditions Fig. S3 from Li et al., 2014
intersegmental vessel aplastic, abnormal y1Tg + MO1-tek standard conditions Fig. 1 from Li et al., 2014
caudal vein morphology, abnormal y1Tg + MO1-tek standard conditions Fig. S3 from Li et al., 2014
dorsal longitudinal anastomotic vessel broken, abnormal y1Tg + MO1-tek standard conditions Fig. S3 from Li et al., 2014
subintestinal vein morphology, abnormal y1Tg + MO1-tek standard conditions Fig. S3 from Li et al., 2014
intersegmental vessel morphology, abnormal s896Tg; y7Tg + MO1-tek standard conditions Fig. 2 from Li et al., 2014
sprouting angiogenesis disrupted, abnormal s896Tg; y7Tg + MO1-tek standard conditions Fig. 2 from Li et al., 2014
intersegmental vessel truncated, abnormal s896Tg; y7Tg + MO1-tek standard conditions Fig. 2 from Li et al., 2014
intersegmental vessel decreased amount, abnormal s896Tg; y7Tg + MO1-tek standard conditions Fig. 2 from Li et al., 2014
intersegmental vessel morphology, abnormal tekbns401/+; y1Tg/+ + MO1-tek standard conditions Fig. 3 with image from Jiang et al., 2020
intersegmental vessel morphology, abnormal tekbns401/bns401; y1Tg/+ + MO1-tek standard conditions Fig. 3 with image from Jiang et al., 2020
intersegmental vessel morphology, abnormal y1Tg + MO1-tek + MO1-vegfaa standard conditions Fig. 4 from Li et al., 2014
intersegmental vessel truncated, abnormal y1Tg + MO1-tek + MO1-vegfaa standard conditions Fig. 4 from Li et al., 2014
sprouting angiogenesis disrupted, abnormal y1Tg + MO1-tek + MO1-vegfaa standard conditions Fig. 4 from Li et al., 2014
Citations