Morpholino

MO4-atg5

ID
ZDB-MRPHLNO-151021-1
Name
MO4-atg5
Previous Names
None
Target
Sequence
5' - CACATCCTTGTCATCTGCCATTATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-atg5
Expressed Gene Anatomy Figures
atg5 Fig. 1 from Lee et al., 2014
bmp4 Fig. 4 from Lee et al., 2014
dbx1b Fig. S7 from Lee et al., 2014
eed Fig. S7 from Lee et al., 2014
her15.1 Fig. S7 from Lee et al., 2014
hoxb2a Fig. S7 from Lee et al., 2014
msx3 Fig. S7 from Lee et al., 2014
myl7 Fig. 4 from Lee et al., 2014
mynn Fig. S7 from Lee et al., 2014
notch1b Fig. 4 from Lee et al., 2014
tbx2b Fig. 5 from Lee et al., 2014
tbx5a Fig. 5 from Lee et al., 2014
vcana Fig. 4 from Lee et al., 2014
znfl2a Fig. S7 from Lee et al., 2014
Phenotype
Phenotype resulting from MO4-atg5
Phenotype Fish Figures
atrioventricular canal tbx2b expression increased distribution, abnormal AB + MO4-atg5 Fig. 5 from Lee et al., 2014
atrioventricular canal tbx2b expression mislocalised, abnormal AB + MO4-atg5 Fig. 5 from Lee et al., 2014
atrium tbx2b expression increased distribution, abnormal AB + MO4-atg5 Fig. 5 from Lee et al., 2014
atrium tbx2b expression mislocalised, abnormal AB + MO4-atg5 Fig. 5 from Lee et al., 2014
autophagosome assembly disrupted, abnormal AB + MO4-atg5 Fig. 1 from Lee et al., 2014
cardiac ventricle tbx2b expression increased distribution, abnormal AB + MO4-atg5 Fig. 5 from Lee et al., 2014
cardiac ventricle bmp4 expression mislocalised, abnormal AB + MO4-atg5 Fig. 4 from Lee et al., 2014
cardiac ventricle vcana expression mislocalised, abnormal AB + MO4-atg5 Fig. 4 from Lee et al., 2014
cardiac ventricle tbx2b expression mislocalised, abnormal AB + MO4-atg5 Fig. 5 from Lee et al., 2014
cardiac ventricle notch1b expression mislocalised, abnormal AB + MO4-atg5 Fig. 4 from Lee et al., 2014
eye decreased size, abnormal AB + MO4-atg5 Fig. 2 from Lee et al., 2014
head decreased size, abnormal AB + MO4-atg5 Fig. 2 from Lee et al., 2014
heart mynn expression increased amount, abnormal AB + MO4-atg5 Fig. S7 from Lee et al., 2014
heart znfl2a expression increased amount, abnormal AB + MO4-atg5 Fig. S7 from Lee et al., 2014
heart her15.1 expression increased amount, abnormal AB + MO4-atg5 Fig. S7 from Lee et al., 2014
heart eed expression increased amount, abnormal AB + MO4-atg5 Fig. S7 from Lee et al., 2014
heart hoxb2a expression increased amount, abnormal AB + MO4-atg5 Fig. S7 from Lee et al., 2014
heart tbx5a expression increased distribution, abnormal AB + MO4-atg5 Fig. 5 from Lee et al., 2014
heart tbx5a expression mislocalised, abnormal AB + MO4-atg5 Fig. 5 from Lee et al., 2014
heart structure, abnormal AB + MO4-atg5 Fig. S1 from Lee et al., 2014
heart looping disrupted, abnormal AB + MO4-atg5 Fig. S1 from Lee et al., 2014
heart looping process quality, abnormal AB + MO4-atg5 Fig. 4 from Lee et al., 2014
heart tube linear, abnormal AB + MO4-atg5 Fig. 4 from Lee et al., 2014
notochord mitochondrion decreased accumulation notochord lysosome, abnormal zf3335Tg + MO4-atg5 Fig. 1 from Wrighton et al., 2021
notochord mitophagy decreased occurrence, abnormal zf3336Tg + MO4-atg5 Fig. 1 from Wrighton et al., 2021
pericardium edematous, abnormal AB + MO4-atg5 Fig. 2 from Lee et al., 2014
post-vent region cell death increased occurrence, abnormal AB + MO4-atg5 Fig. 2 from Lee et al., 2014
pronephric duct cystic, abnormal WIK + MO4-atg5 Fig. 4 from Zhu et al., 2017
pronephros development decreased process quality, abnormal WIK + MO4-atg5 Fig. 4 from Zhu et al., 2017
whole organism bent, abnormal AB + MO4-atg5 Fig. 2 from Lee et al., 2014
whole organism atg5 expression decreased amount, abnormal AB + MO4-atg5 Fig. 1 from Lee et al., 2014
whole organism viability, abnormal AB + MO4-atg5 Fig. S4 from Lee et al., 2014
Phenotype of all Fish created by or utilizing MO4-atg5
Phenotype Fish Conditions Figures
eye decreased size, abnormal AB + MO4-atg5 standard conditions Fig. 2 from Lee et al., 2014
whole organism bent, abnormal AB + MO4-atg5 standard conditions Fig. 2 from Lee et al., 2014
heart mynn expression increased amount, abnormal AB + MO4-atg5 standard conditions Fig. S7 from Lee et al., 2014
autophagosome assembly disrupted, abnormal AB + MO4-atg5 control Fig. 1 from Lee et al., 2014
heart her15.1 expression increased amount, abnormal AB + MO4-atg5 standard conditions Fig. S7 from Lee et al., 2014
heart tube linear, abnormal AB + MO4-atg5 standard conditions Fig. 4 from Lee et al., 2014
cardiac ventricle vcana expression mislocalised, abnormal AB + MO4-atg5 standard conditions Fig. 4 from Lee et al., 2014
cardiac ventricle tbx2b expression mislocalised, abnormal AB + MO4-atg5 standard conditions Fig. 5 from Lee et al., 2014
whole organism viability, abnormal AB + MO4-atg5 standard conditions Fig. S4 from Lee et al., 2014
cardiac ventricle tbx2b expression increased distribution, abnormal AB + MO4-atg5 standard conditions Fig. 5 from Lee et al., 2014
pericardium edematous, abnormal AB + MO4-atg5 standard conditions Fig. 2 from Lee et al., 2014
heart tbx5a expression mislocalised, abnormal AB + MO4-atg5 standard conditions Fig. 5 from Lee et al., 2014
heart hoxb2a expression increased amount, abnormal AB + MO4-atg5 standard conditions Fig. S7 from Lee et al., 2014
heart looping process quality, abnormal AB + MO4-atg5 standard conditions Fig. 4 from Lee et al., 2014
cardiac ventricle bmp4 expression mislocalised, abnormal AB + MO4-atg5 standard conditions Fig. 4 from Lee et al., 2014
atrioventricular canal tbx2b expression increased distribution, abnormal AB + MO4-atg5 standard conditions Fig. 5 from Lee et al., 2014
heart tbx5a expression increased distribution, abnormal AB + MO4-atg5 standard conditions Fig. 5 from Lee et al., 2014
heart znfl2a expression increased amount, abnormal AB + MO4-atg5 standard conditions Fig. S7 from Lee et al., 2014
heart eed expression increased amount, abnormal AB + MO4-atg5 standard conditions Fig. S7 from Lee et al., 2014
cardiac ventricle notch1b expression mislocalised, abnormal AB + MO4-atg5 standard conditions Fig. 4 from Lee et al., 2014
whole organism atg5 expression decreased amount, abnormal AB + MO4-atg5 control Fig. 1 from Lee et al., 2014
head decreased size, abnormal AB + MO4-atg5 standard conditions Fig. 2 from Lee et al., 2014
atrium tbx2b expression increased distribution, abnormal AB + MO4-atg5 standard conditions Fig. 5 from Lee et al., 2014
heart structure, abnormal AB + MO4-atg5 standard conditions Fig. S1 from Lee et al., 2014
post-vent region cell death increased occurrence, abnormal AB + MO4-atg5 standard conditions Fig. 2 from Lee et al., 2014
atrioventricular canal tbx2b expression mislocalised, abnormal AB + MO4-atg5 standard conditions Fig. 5 from Lee et al., 2014
heart looping disrupted, abnormal AB + MO4-atg5 standard conditions Fig. S1 from Lee et al., 2014
atrium tbx2b expression mislocalised, abnormal AB + MO4-atg5 standard conditions Fig. 5 from Lee et al., 2014
pronephros development decreased process quality, abnormal WIK + MO4-atg5 standard conditions Fig. 4 from Zhu et al., 2017
pronephric duct cystic, abnormal WIK + MO4-atg5 standard conditions Fig. 4 from Zhu et al., 2017
notochord mitochondrion decreased accumulation notochord lysosome, abnormal zf3335Tg + MO4-atg5 standard conditions Fig. 1 from Wrighton et al., 2021
notochord mitophagy decreased occurrence, abnormal zf3335Tg + MO4-atg5 standard conditions Fig. 1 from Wrighton et al., 2021
notochord mitochondrion decreased accumulation notochord lysosome, abnormal zf3336Tg + MO4-atg5 standard conditions Fig. 1 from Wrighton et al., 2021
notochord mitophagy decreased occurrence, abnormal zf3336Tg + MO4-atg5 standard conditions Fig. 1 from Wrighton et al., 2021
pronephros development decreased process quality, abnormal pkd1azf1067/zf1067 + MO4-atg5 standard conditions Fig. 4 from Zhu et al., 2017
pronephric duct cystic, exacerbated pkd1azf1067/zf1067 + MO4-atg5 standard conditions Fig. 4 from Zhu et al., 2017
whole organism bent, abnormal tp53zdf1/zdf1 + MO4-atg5 standard conditions Fig. S3 from Lee et al., 2014
heart physical object quality, abnormal tp53zdf1/zdf1 + MO4-atg5 standard conditions Fig. S3 from Lee et al., 2014
whole organism cell death increased occurrence, abnormal tp53zdf1/zdf1 + MO4-atg5 standard conditions Fig. S3 from Lee et al., 2014
head decreased size, abnormal tp53zdf1/zdf1 + MO4-atg5 standard conditions Fig. S3 from Lee et al., 2014
pronephros cystic, exacerbated li1Tg + MO3-pkd2 + MO4-atg5 standard conditions Fig. 7 with image from Chang et al., 2017
pronephros morphogenesis decreased process quality, abnormal li1Tg + MO3-pkd2 + MO4-atg5 standard conditions Fig. 7 with image from Chang et al., 2017
cell autophagosome assembly decreased process quality, abnormal zf155Tg + MO4-atg5 control Fig. 1 from Lee et al., 2014
atrium increased size, abnormal zf155Tg + MO4-atg5 standard conditions Fig. 3 from Lee et al., 2014
pericardium edematous, abnormal zf155Tg + MO4-atg5 standard conditions Fig. 3 from Lee et al., 2014
heart autophagosome decreased amount, abnormal zf155Tg + MO4-atg5 standard conditions Fig. 3,  Fig. S5 from Lee et al., 2014
heart looping process quality, abnormal zf155Tg + MO4-atg5 standard conditions Fig. 3 from Lee et al., 2014
cardiac ventricle orientation atrium, abnormal zf155Tg + MO4-atg5 standard conditions Fig. 3 from Lee et al., 2014
autophagy decreased occurrence, abnormal zf155Tg + MO4-atg5 (AB) primary cell culture: blastomere Fig. 1 from Lee et al., 2016
cell autophagosome decreased amount, abnormal zf155Tg + MO4-atg5 (AB) primary cell culture: blastomere Fig. 1 from Lee et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.