Morpholino

MO1-syngap1b

ID
ZDB-MRPHLNO-150928-10
Name
MO1-syngap1b
Previous Names
  • syngap1b (1)
Target
Sequence
5' - TCCTGTGAGGGAGCAATAACAGCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-syngap1b
No data available
Phenotype
Phenotype resulting from MO1-syngap1b
Phenotype of all Fish created by or utilizing MO1-syngap1b
Phenotype Fish Conditions Figures
hindbrain GABAergic neuron decreased amount, abnormal WT + MO1-syngap1b standard conditions Fig. 6 from Kozol et al., 2015
hindbrain glutamatergic neuron decreased amount, abnormal WT + MO1-syngap1b standard conditions Fig. 6 from Kozol et al., 2015
midbrain hindbrain boundary morphology, abnormal WT + MO1-syngap1b standard conditions Fig. 5 from Kozol et al., 2015
thigmotaxis disrupted, abnormal WT + MO1-syngap1b standard conditions Fig. 4 from Kozol et al., 2015
whole organism dead, abnormal WT + MO1-syngap1b standard conditions Fig. 3 from Kozol et al., 2015
embryo development delayed, abnormal WT + MO1-syngap1b standard conditions Fig. 5 from Kozol et al., 2015
midbrain GABAergic neuron decreased amount, abnormal WT + MO1-syngap1b standard conditions Fig. 6 from Kozol et al., 2015
brain development delayed, abnormal WT + MO1-syngap1b standard conditions Fig. 5 from Kozol et al., 2015
swimming behavior disrupted, abnormal WT + MO1-syngap1b standard conditions Fig. 3Fig. 4 from Kozol et al., 2015
brain decreased size, abnormal WT + MO1-syngap1b standard conditions Fig. 6 from Kozol et al., 2015
midbrain apoptotic, abnormal nksaigff213aGt; nns14Tg + MO1-syngap1b standard conditions Fig. 8 from Kozol et al., 2015
apoptotic process increased occurrence, abnormal nksaigff213aGt; nns14Tg + MO1-syngap1b standard conditions Fig. 8 from Kozol et al., 2015
spinal cord apoptotic, abnormal nksaigff213aGt; nns14Tg + MO1-syngap1b standard conditions Fig. 8 from Kozol et al., 2015
hindbrain apoptotic, abnormal nksaigff213aGt; nns14Tg + MO1-syngap1b standard conditions Fig. 8 from Kozol et al., 2015
thigmotaxis disrupted, abnormal WT + MO1-syngap1a + MO1-syngap1b standard conditions Fig. 4 from Kozol et al., 2015
swimming behavior disrupted, abnormal WT + MO1-syngap1a + MO1-syngap1b standard conditions Fig. 3Fig. 4 from Kozol et al., 2015
midbrain hindbrain boundary morphology, abnormal WT + MO1-syngap1b + MO2-shank3a standard conditions Fig. 3 from Kozol et al., 2015
thigmotaxis disrupted, abnormal WT + MO1-syngap1b + MO2-shank3a standard conditions Fig. 4 from Kozol et al., 2015
embryo development delayed, abnormal WT + MO1-syngap1b + MO2-shank3a standard conditions Fig. 3 from Kozol et al., 2015
swimming behavior disrupted, abnormal WT + MO1-syngap1b + MO2-shank3a standard conditions Fig. 3Fig. 4 from Kozol et al., 2015
heart edematous, abnormal WT + MO1-syngap1b + MO2-shank3a standard conditions Fig. 3 from Kozol et al., 2015
hindbrain apoptotic, abnormal nksaigff213aGt; nns14Tg + MO1-syngap1b + MO2-shank3a standard conditions text only from Kozol et al., 2015
apoptotic process increased occurrence, abnormal nksaigff213aGt; nns14Tg + MO1-syngap1b + MO2-shank3a standard conditions text only from Kozol et al., 2015
midbrain apoptotic, abnormal nksaigff213aGt; nns14Tg + MO1-syngap1b + MO2-shank3a standard conditions text only from Kozol et al., 2015
Citations