Morpholino

MO1-inf2

ID
ZDB-MRPHLNO-150928-1
Name
MO1-inf2
Previous Names
  • ATG MO (1)
Target
Sequence
5' - GGGCTCCCTCTGCCTTCATCGACAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-inf2
Expressed Gene Anatomy Figures
nphs1 Fig. 4 with image from Sun et al., 2014
Phenotype
Phenotype resulting from MO1-inf2
Phenotype Fish Figures
glomerular basement membrane increased permeability, abnormal WT + MO1-inf2 Fig. 5 with image from Sun et al., 2014
glomerular basement membrane microvillus crowded, abnormal WT + MO1-inf2 Fig. 4 with image from Sun et al., 2014
glomerular basement membrane podocyte foot irregularly shaped, abnormal WT + MO1-inf2 Fig. 4 with image from Sun et al., 2014
glomerular basement membrane podocyte foot protruding, abnormal WT + MO1-inf2 Fig. 4 with image from Sun et al., 2014
glomerular basement membrane slit diaphragm absent, abnormal WT + MO1-inf2 Fig. 4 with image from Sun et al., 2014
glomerular filtration disrupted, abnormal WT + MO1-inf2 Fig. 5 with image from Sun et al., 2014
pericardium edematous, abnormal WT + MO1-inf2 Fig. 3 with image from Sun et al., 2014
post-vent region sarcomere disorganized, abnormal WT + MO1-inf2 Fig. 3 with image from Sun et al., 2014
pronephric glomerulus hypoplastic, abnormal WT + MO1-inf2 Fig. 3 with image from Sun et al., 2014
pronephric tubule distended, abnormal WT + MO1-inf2 Fig. 3 with image from Sun et al., 2014
pronephros immature, abnormal WT + MO1-inf2 Fig. 3 with image from Sun et al., 2014
pronephros morphology, abnormal WT + MO1-inf2 Fig. 7 with image from Sun et al., 2014
renal glomerulus immature, abnormal WT + MO1-inf2 Fig. 3 with image from Sun et al., 2014
renal glomerulus slit diaphragm decreased functionality, abnormal WT + MO1-inf2 Fig. 5 with image from Sun et al., 2014
whole organism viability, abnormal WT + MO1-inf2 Fig. 7 with image from Sun et al., 2014
whole organism wholly dorsalized, abnormal WT + MO1-inf2 Fig. 3 with image from Sun et al., 2014
Phenotype of all Fish created by or utilizing MO1-inf2
Phenotype Fish Conditions Figures
renal glomerulus immature, abnormal WT + MO1-inf2 standard conditions Fig. 3 with image from Sun et al., 2014
glomerular basement membrane podocyte foot irregularly shaped, abnormal WT + MO1-inf2 standard conditions Fig. 4 with image from Sun et al., 2014
whole organism wholly dorsalized, abnormal WT + MO1-inf2 standard conditions Fig. 3 with image from Sun et al., 2014
pronephric tubule distended, abnormal WT + MO1-inf2 standard conditions Fig. 3 with image from Sun et al., 2014
pericardium edematous, abnormal WT + MO1-inf2 standard conditions Fig. 3 with image from Sun et al., 2014
glomerular basement membrane podocyte foot protruding, abnormal WT + MO1-inf2 standard conditions Fig. 4 with image from Sun et al., 2014
glomerular basement membrane microvillus crowded, abnormal WT + MO1-inf2 standard conditions Fig. 4 with image from Sun et al., 2014
pronephros immature, abnormal WT + MO1-inf2 standard conditions Fig. 3 with image from Sun et al., 2014
pronephros morphology, abnormal WT + MO1-inf2 standard conditions Fig. 7 with image from Sun et al., 2014
glomerular basement membrane slit diaphragm absent, abnormal WT + MO1-inf2 standard conditions Fig. 4 with image from Sun et al., 2014
renal glomerulus slit diaphragm decreased functionality, abnormal WT + MO1-inf2 standard conditions Fig. 5 with image from Sun et al., 2014
post-vent region sarcomere disorganized, abnormal WT + MO1-inf2 standard conditions Fig. 3 with image from Sun et al., 2014
whole organism viability, abnormal WT + MO1-inf2 standard conditions Fig. 7 with image from Sun et al., 2014
glomerular basement membrane increased permeability, abnormal WT + MO1-inf2 standard conditions Fig. 5 with image from Sun et al., 2014
pronephric glomerulus hypoplastic, abnormal WT + MO1-inf2 standard conditions Fig. 3 with image from Sun et al., 2014
glomerular filtration disrupted, abnormal WT + MO1-inf2 standard conditions Fig. 5 with image from Sun et al., 2014
Citations