Morpholino
MO1-flvcr1
- ID
- ZDB-MRPHLNO-150916-4
- Name
- MO1-flvcr1
- Previous Names
- None
- Target
- Sequence
-
5' - CCTGGAGAAACTCACCTGCCACCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-flvcr1
No data available
Phenotype
Phenotype resulting from MO1-flvcr1
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO1-flvcr1
1 - 5 of 6 Show all
Citations
- Petrillo, S., De Giorgio, F., Bertino, F., Garello, F., Bitonto, V., Longo, D.L., Mercurio, S., Ammirata, G., Allocco, A.L., Fiorito, V., Chiabrando, D., Altruda, F., Terreno, E., Provero, P., Munaron, L., Genova, T., Nóvoa, A., Carlos, A.R., Cardoso, S., Mallo, M., Soares, M.P., Tolosano, E. (2023) Endothelial cells require functional FLVCR1a during developmental and adult angiogenesis. Angiogenesis. 26(3):365-384
- Mercurio, S., Petrillo, S., Chiabrando, D., Bassi, Z.I., Gays, D., Camporeale, A., Vacaru, A., Miniscalco, B., Valperga, G., Silengo, L., Altruda, F., Baron, M.H., Santoro, M.M., Tolosano, E. (2015) The Heme Exporter Flvcr1 Regulates Expansion And Differentiation Of Committed Erythroid Progenitors By Controlling Intracellular Heme Accumulation. Haematologica. 100(6):720-9
1 - 2 of 2
Show