Morpholino
MO1-slc7a7
- ID
- ZDB-MRPHLNO-150831-1
- Name
- MO1-slc7a7
- Previous Names
- None
- Target
- Sequence
-
5' - AAAGTGTTTATTACTCACCACAGCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-slc7a7
Expressed Gene | Anatomy | Figures |
---|---|---|
mpeg1.1 |
Fig. 3 ![]() |
1 - 1 of 1
Phenotype
Phenotype resulting from MO1-slc7a7
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO1-slc7a7
1 - 4 of 4
Citations
- Demy, D.L., Carrère, M., Noche, R., Tauzin, M., Le Bris, M., Baek, C., Leshchiner, I., Goessling, W., Herbomel, P. (2020) The cationic amino acid exporter Slc7a7 is induced and vital in tissue macrophages with sustained efferocytic activity. Journal of Cell Science. 133(20):
- Liu, C., Wu, C., Yang, Q., Gao, J., Li, L., Yang, D., Luo, L. (2016) Macrophages Mediate the Repair of Brain Vascular Rupture through Direct Physical Adhesion and Mechanical Traction. Immunity. 44(5):1162-76
- Rossi, F., Casano, A.M., Henke, K., Richter, K., Peri, F. (2015) The SLC7A7 Transporter Identifies Microglial Precursors prior to Entry into the Brain. Cell Reports. 11(7):1008-17
1 - 3 of 3
Show