header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-150807-3
Morpholino Name: MO4-smyd2a
Target: smyd2a (1)
Sequence:
5' - TTATAAGGAGCGCTGACCTGGTAAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-smyd2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-smyd2a
Expressed Gene Anatomy Figures
bmp2a Fig. 5 with image from Sesé et al., 2013
chrd Fig. 5 with image from Sesé et al., 2013
ctnnb1 Fig. 5 with image from Sesé et al., 2013
gsc Fig. 5 with image from Sesé et al., 2013
mixl1 Fig. 5 with image from Sesé et al., 2013
smyd2a Fig. 4 with image from Sesé et al., 2013
smyd2b Fig. 4 with image from Sesé et al., 2013
sox32 Fig. 5 with image from Sesé et al., 2013
tbxta Fig. 5 with image from Sesé et al., 2013
PHENOTYPE
Phenotype resulting from MO4-smyd2a
Phenotype of all Fish created by or utilizing MO4-smyd2a
Genome Resources:
CITATIONS (1)