Morpholino
MO1-idh1
- ID
- ZDB-MRPHLNO-150806-1
- Name
- MO1-idh1
- Previous Names
- None
- Target
- Sequence
-
5' - TCTGTTTCTTGAAGAGTCCATATGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-idh1
| Expressed Gene | Anatomy | Figures |
|---|---|---|
| lcp1 |
Fig. 2
from Shi et al., 2015 |
|
| mpeg1.1 |
Fig. 2
from Shi et al., 2015 |
|
| mpx |
Fig. 2
from Shi et al., 2015 |
|
| myb |
Fig. 3
from Shi et al., 2015 |
|
| rag1 |
Fig. 3
from Shi et al., 2015 |
|
| spi1b |
Fig. 2
from Shi et al., 2015 |
Phenotype
Phenotype resulting from MO1-idh1
| Phenotype | Fish | Figures |
|---|---|---|
| whole organism has extra parts of type common myeloid progenitor, abnormal | WT + MO1-idh1 |
Fig. 2
from Shi et al., 2015 |
Phenotype of all Fish created by or utilizing MO1-idh1
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| whole organism has extra parts of type common myeloid progenitor, abnormal | WT + MO1-idh1 | standard conditions |
Fig. 2
from Shi et al., 2015 |
Citations