Morpholino
MO1-adora2b
- ID
- ZDB-MRPHLNO-150803-1
- Name
- MO1-adora2b
- Previous Names
- None
- Target
- Sequence
-
5' - CAATGGCGATGTAGAGCGAATCCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-adora2b
Expressed Gene | Anatomy | Figures |
---|---|---|
cdh17 |
Fig. 3
from Jing et al., 2015 |
|
efnb2a |
Fig. 3
from Jing et al., 2015 |
|
gata1a |
Fig. 3
from Jing et al., 2015 |
|
kdrl |
Fig. 3
from Jing et al., 2015 |
|
myb |
Fig. 2,
Fig. 3,
Fig. 5,
Fig. 6,
Fig. 7,
Fig. 8
from Jing et al., 2015 |
1 - 5 of 9 Show all
Phenotype
Phenotype resulting from MO1-adora2b
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO1-adora2b
1 - 4 of 4
Citations
- Gessler, S., Guthmann, C., Schuler, V., Lilienkamp, M., Walz, G., Yakulov, T.A. (2022) Control of Directed Cell Migration after Tubular Cell Injury by Nucleotide Signaling. International Journal of Molecular Sciences. 23(14):
- Jing, L., Tamplin, O.J., Chen, M.J., Deng, Q., Patterson, S., Kim, P.G., Durand, E.M., McNeil, A., Green, J.M., Matsuura, S., Ablain, J., Brandt, M.K., Schlaeger, T.M., Huttenlocher, A., Daley, G.Q., Ravid, K., Zon, L.I. (2015) Adenosine signaling promotes hematopoietic stem and progenitor cell emergence. The Journal of experimental medicine. 212(5):649-63
1 - 2 of 2
Show