Morpholino

MO1-tatdn1

ID

ZDB-MRPHLNO-150717-2

Name

MO1-tatdn1

Previous Names

Target

Sequence

5' - TCATGGCGAGTTTAGCAGAAACAGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tatdn1

No data available

Phenotype

Phenotype resulting from MO1-tatdn1

Phenotype	Fish	Figures
DNA replication disrupted, abnormal	AB + MO1-tatdn1	Fig. 4 from Yang et al., 2012
embryo development delayed, abnormal	AB + MO1-tatdn1	Fig. 5 from Yang et al., 2012
eye apoptotic, abnormal	AB + MO1-tatdn1	Fig. S2 from Yang et al., 2012
eye decreased size, abnormal	AB + MO1-tatdn1	Fig. 5 from Yang et al., 2012
eye apoptotic process increased occurrence, abnormal	AB + MO1-tatdn1	Fig. S2 from Yang et al., 2012
eye cell decreased amount, abnormal	AB + MO1-tatdn1	Fig. 5 from Yang et al., 2012
eye cell polyploid, abnormal	AB + MO1-tatdn1	Fig. 4 from Yang et al., 2012
eye cell cycle delayed, abnormal	AB + MO1-tatdn1	Fig. 4 from Yang et al., 2012
eye nucleus shape, abnormal	AB + MO1-tatdn1	Fig. 5 from Yang et al., 2012
retina layer formation disrupted, abnormal	AB + MO1-tatdn1	Fig. 5 from Yang et al., 2012
swimming process quality, abnormal	AB + MO1-tatdn1	Fig. 5 from Yang et al., 2012
yolk syncytial layer morphology, abnormal	AB + MO1-tatdn1	Fig. 5 from Yang et al., 2012

Phenotype of all Fish created by or utilizing MO1-tatdn1

Phenotype	Fish	Conditions	Figures
eye cell decreased amount, abnormal	AB + MO1-tatdn1	standard conditions	Fig. 5 from Yang et al., 2012
retina layer formation disrupted, abnormal	AB + MO1-tatdn1	standard conditions	Fig. 5 from Yang et al., 2012
eye apoptotic, abnormal	AB + MO1-tatdn1	standard conditions	Fig. S2 from Yang et al., 2012
swimming process quality, abnormal	AB + MO1-tatdn1	standard conditions	Fig. 5 from Yang et al., 2012
DNA replication disrupted, abnormal	AB + MO1-tatdn1	standard conditions	Fig. 4 from Yang et al., 2012
embryo development delayed, abnormal	AB + MO1-tatdn1	standard conditions	Fig. 5 from Yang et al., 2012
eye apoptotic process increased occurrence, abnormal	AB + MO1-tatdn1	standard conditions	Fig. S2 from Yang et al., 2012
eye cell cycle delayed, abnormal	AB + MO1-tatdn1	standard conditions	Fig. 4 from Yang et al., 2012
eye nucleus shape, abnormal	AB + MO1-tatdn1	standard conditions	Fig. 5 from Yang et al., 2012
eye decreased size, abnormal	AB + MO1-tatdn1	standard conditions	Fig. 5 from Yang et al., 2012
yolk syncytial layer morphology, abnormal	AB + MO1-tatdn1	standard conditions	Fig. 5 from Yang et al., 2012
eye cell polyploid, abnormal	AB + MO1-tatdn1	standard conditions	Fig. 4 from Yang et al., 2012

Citations