Morpholino

MO1-hif1aa

ID

ZDB-MRPHLNO-150617-2

Name

MO1-hif1aa

Previous Names

None

Target

hif1aa (1)

Sequence

5' - TTTTCCCAGGTGCGACTGCCTCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-hif1aa

No data available

Phenotype

Phenotype resulting from MO1-hif1aa

No data available

Phenotype of all Fish created by or utilizing MO1-hif1aa

Phenotype	Fish	Conditions	Figures
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal	WT + MO1-hif1aa + MO1-hif1ab	heat shock	Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta myb expression decreased amount, abnormal	WT + MO1-hif1aa + MO1-hif1ab	standard conditions	Fig. 6 from Gerri et al., 2018
hematopoietic system myb expression decreased amount, abnormal	WT + MO1-hif1aa + MO1-hif1ab	standard conditions	Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal	WT + MO1-hif1aa + MO1-hif1ab	standard conditions	Fig. 6 from Gerri et al., 2018
hematopoietic system runx1 expression decreased amount, abnormal	WT + MO1-hif1aa + MO1-hif1ab	standard conditions	Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta myb expression decreased amount, abnormal	WT + MO1-hif1aa + MO1-hif1ab	heat shock	Fig. 6 from Gerri et al., 2018
hematopoietic system runx1 expression decreased amount, abnormal	WT + MO1-hif1aa + MO1-hif1ab	heat shock	Fig. 6 from Gerri et al., 2018
hematopoietic system myb expression decreased amount, abnormal	WT + MO1-hif1aa + MO1-hif1ab	heat shock	Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta myb expression increased amount, abnormal	kca3Tg; kca4Tg + MO1-hif1aa + MO1-hif1ab	heat shock	Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta runx1 expression increased amount, abnormal	kca3Tg; kca4Tg + MO1-hif1aa + MO1-hif1ab	heat shock	Fig. 6 from Gerri et al., 2018
hematopoietic system runx1 expression increased amount, abnormal	kca3Tg; kca4Tg + MO1-hif1aa + MO1-hif1ab	heat shock	Fig. 6 from Gerri et al., 2018
hematopoietic system myb expression increased amount, abnormal	kca3Tg; kca4Tg + MO1-hif1aa + MO1-hif1ab	heat shock	Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta runx1 expression increased amount, abnormal	kca3Tg; ubs4Tg + MO1-hif1aa + MO1-hif1ab	standard conditions	Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta myb expression increased amount, abnormal	kca3Tg; ubs4Tg + MO1-hif1aa + MO1-hif1ab	standard conditions	Fig. 6 from Gerri et al., 2018
hematopoietic system runx1 expression increased amount, abnormal	kca3Tg; ubs4Tg + MO1-hif1aa + MO1-hif1ab	standard conditions	Fig. 6 from Gerri et al., 2018
hematopoietic system myb expression increased amount, abnormal	kca3Tg; ubs4Tg + MO1-hif1aa + MO1-hif1ab	standard conditions	Fig. 6 from Gerri et al., 2018
ventral wall of dorsal aorta hematopoietic cell decreased amount, abnormal	s896Tg; zf169Tg + MO1-hif1aa + MO1-hif1ab	standard conditions	Fig. 2 from Gerri et al., 2018
hematopoietic stem cell decreased amount, abnormal	s896Tg; zf169Tg + MO1-hif1aa + MO1-hif1ab	standard conditions	Fig. 2 from Gerri et al., 2018

Citations