Morpholino

MO3-sox4b

ID
ZDB-MRPHLNO-150515-2
Name
MO3-sox4b
Previous Names
None
Target
Sequence
5' - ACGCGCCTTCAGTCGTGCTTAGTGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-sox4b
No data available
Phenotype
Phenotype resulting from MO3-sox4b
No data available
Phenotype of all Fish created by or utilizing MO3-sox4b
Phenotype Fish Conditions Figures
optic fissure closure incomplete, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 2 with imageFig. 3 with imageFig. 5 with imageFig. 9 with image from Wen et al., 2015
retina cell population proliferation decreased process quality, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 4 with image from Wen et al., 2015
closure of optic fissure decreased process quality, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 2 with imageFig. 3 with imageFig. 5 with imageFig. 9 with image from Wen et al., 2015
retinal ganglion cell layer cell population proliferation increased occurrence, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 4 with image from Wen et al., 2015
retina protruding into brain, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 2 with image from Wen et al., 2015
retinal pigmented epithelium broken, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 2 with image from Wen et al., 2015
smoothened signaling pathway increased process quality, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 6 with image from Wen et al., 2015
retina apoptotic process increased process quality, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 4 with image from Wen et al., 2015
optic fissure morphology, abnormal WT + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 2 with image from Wen et al., 2015
optic fissure closure incomplete, abnormal WT + MO1-sox11b + MO2-sox11a + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 9 with image from Wen et al., 2015
closure of optic fissure decreased process quality, abnormal WT + MO1-sox11b + MO2-sox11a + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 9 with image from Wen et al., 2015
lens malformed, abnormal WT + MO1-sox11b + MO2-sox11a + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 9 with image from Wen et al., 2015
smoothened signaling pathway increased process quality, abnormal umz24Tg + MO2-sox4a + MO3-sox4b + MO4-tp53 standard conditions Fig. 5 with image from Wen et al., 2015
Citations