Morpholino

MO1-mdga2a

ID

ZDB-MRPHLNO-150511-2

Name

MO1-mdga2a

Previous Names

MDGA2A-MO-A (1)

Target

mdga2a (1)

Sequence

5' - ACAGGAGAGCCCAGATAATATCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-mdga2a

Expressed Gene	Anatomy	Figures
mdga2a	(not) cranial nerve V medial longitudinal fasciculus (not) otic vesicle hair cell posterior lateral line	Fig. 3 from Ingold et al., 2015

Phenotype

Phenotype resulting from MO1-mdga2a

Phenotype	Fish	Figures
cranial nerve V mdga2a expression absent, abnormal	WT + MO1-mdga2a	Fig. 3 from Ingold et al., 2015
cranial nerve V GFP expression decreased amount, abnormal	rw0Tg + MO1-mdga2a	Fig. 3 from Ingold et al., 2015
cranial nerve VII GFP expression decreased amount, abnormal	rw0Tg + MO1-mdga2a	Fig. 3 from Ingold et al., 2015
cranial nerve VII axon defasciculated, abnormal	rw0Tg + MO1-mdga2a	Fig. 5 from Ingold et al., 2015
cranial nerve VII collateral sprouting in absence of injury increased occurrence, abnormal	rw0Tg + MO1-mdga2a	Fig. 5 from Ingold et al., 2015
facial nerve formation decreased process quality, abnormal	rw0Tg + MO1-mdga2a	Fig. 5 from Ingold et al., 2015
medial longitudinal fasciculus mdga2a expression decreased amount, abnormal	WT + MO1-mdga2a	Fig. 3 from Ingold et al., 2015
otic vesicle hair cell mdga2a expression absent, abnormal	WT + MO1-mdga2a	Fig. 3 from Ingold et al., 2015
posterior lateral line mdga2a expression decreased amount, abnormal	WT + MO1-mdga2a	Fig. 3 from Ingold et al., 2015
trigeminal motor nucleus cranial motor neuron mislocalised, abnormal	rw0Tg + MO1-mdga2a	Fig. 3 , Fig. 4 from Ingold et al., 2015
trigeminal motor nucleus motor neuron migration process quality, abnormal	rw0Tg + MO1-mdga2a	Fig. 3 , Fig. 4 from Ingold et al., 2015
trigeminal motor nucleus development decreased process quality, abnormal	rw0Tg + MO1-mdga2a	Fig. 3 , Fig. 4 from Ingold et al., 2015

Phenotype of all Fish created by or utilizing MO1-mdga2a

Phenotype	Fish	Conditions	Figures
medial longitudinal fasciculus mdga2a expression decreased amount, abnormal	WT + MO1-mdga2a	standard conditions	Fig. 3 from Ingold et al., 2015
posterior lateral line mdga2a expression decreased amount, abnormal	WT + MO1-mdga2a	standard conditions	Fig. 3 from Ingold et al., 2015
cranial nerve V mdga2a expression absent, abnormal	WT + MO1-mdga2a	standard conditions	Fig. 3 from Ingold et al., 2015
otic vesicle hair cell mdga2a expression absent, abnormal	WT + MO1-mdga2a	standard conditions	Fig. 3 from Ingold et al., 2015
trigeminal motor nucleus motor neuron migration process quality, abnormal	rw0Tg + MO1-mdga2a	standard conditions	Fig. 3 , Fig. 4 from Ingold et al., 2015
facial nerve formation decreased process quality, abnormal	rw0Tg + MO1-mdga2a	standard conditions	Fig. 5 from Ingold et al., 2015
cranial nerve VII GFP expression decreased amount, abnormal	rw0Tg + MO1-mdga2a	standard conditions	Fig. 3 from Ingold et al., 2015
cranial nerve VII collateral sprouting in absence of injury increased occurrence, abnormal	rw0Tg + MO1-mdga2a	standard conditions	Fig. 5 from Ingold et al., 2015
trigeminal motor nucleus cranial motor neuron mislocalised, abnormal	rw0Tg + MO1-mdga2a	standard conditions	Fig. 3 , Fig. 4 from Ingold et al., 2015
cranial nerve VII axon defasciculated, abnormal	rw0Tg + MO1-mdga2a	standard conditions	Fig. 5 from Ingold et al., 2015
cranial nerve V GFP expression decreased amount, abnormal	rw0Tg + MO1-mdga2a	standard conditions	Fig. 3 from Ingold et al., 2015
trigeminal motor nucleus development decreased process quality, abnormal	rw0Tg + MO1-mdga2a	standard conditions	Fig. 3 , Fig. 4 from Ingold et al., 2015

Citations