Morpholino

MO1-plxna2

ID
ZDB-MRPHLNO-150427-2
Name
MO1-plxna2
Previous Names
  • plxna2 e3i3 MO (1)
Target
Sequence
5' - AAAAGCGATGTCTTTCTCACCTTCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
splice MO targeted to exon 3 - intron 3 junction, verified by RT-PCR to exclude exon 3, resulting in a frameshift mutation
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-plxna2
No data available
Phenotype
Phenotype resulting from MO1-plxna2
Phenotype Fish Figures
eye decreased size, abnormal zf460Tg + MO1-plxna2 Fig. 1 with image from Emerson et al., 2017
Fig. 7 from St Clair et al., 2017
Fig. 8 with image from Ebert et al., 2014
midbrain physical object quality, abnormal WT + MO1-plxna2 Fig. 1 with image from Ebert et al., 2014
optic cup cell population proliferation decreased occurrence, abnormal zf460Tg + MO1-plxna2 Fig. 1 with image from Emerson et al., 2017
optic vesicle decreased size, abnormal zf460Tg + MO1-plxna2 Fig. 1 with imageFig. 2 with imageFig. 5 with image from Ebert et al., 2014
optic vesicle edge shape, abnormal zf460Tg + MO1-plxna2 Fig. 2 with image from Ebert et al., 2014
optic vesicle shtn1 expression increased amount, abnormal WT + MO1-plxna2 + MO4-tp53 Fig. 2 with image from Emerson et al., 2020
optic vesicle looseness, abnormal zf460Tg + MO1-plxna2 Fig. 3 with image from Ebert et al., 2014
optic vesicle GFP expression spatial pattern, abnormal zf460Tg + MO1-plxna2 Fig. 2 with image from Emerson et al., 2020
optic vesicle unstructured, abnormal zf460Tg + MO1-plxna2 Fig. 4 with image from Ebert et al., 2014
optic vesicle apoptotic process increased occurrence, abnormal zf460Tg + MO1-plxna2 Fig. 4 with imageFig. 5 with image from Ebert et al., 2014
optic vesicle cell mislocalised, abnormal zf460Tg + MO1-plxna2 Fig. 3 with imageFig. 4 with imageFig. 5 with image from Ebert et al., 2014
optic vesicle cell mislocalised medially, abnormal WT + MO1-plxna2 Fig. 1 with imageFig. 2 with image from Ebert et al., 2014
optic vesicle regionalization decreased process quality, abnormal WT + MO1-plxna2 Fig. 7 with image from Ebert et al., 2014
optic vesicle formation decreased process quality, abnormal zf460Tg + MO1-plxna2 Fig. 1 with imageFig. 2 with imageFig. 3 with imageFig. 5 with image from Ebert et al., 2014
whole organism dcdc2b expression increased amount, abnormal WT + MO1-plxna2 Fig. 4 with image from Emerson et al., 2017
whole organism rasl11b expression increased amount, abnormal WT + MO1-plxna2 Fig. 4 with image from Emerson et al., 2017
whole organism shtn1 expression increased amount, abnormal WT + MO1-plxna2 Fig. 4 with image from Emerson et al., 2017
whole organism mmp2 expression increased amount, abnormal WT + MO1-plxna2 Fig. 4 with image from Emerson et al., 2017
whole organism rbl2 expression increased amount, abnormal WT + MO1-plxna2 Fig. 4 with image from Emerson et al., 2017
Phenotype of all Fish created by or utilizing MO1-plxna2
Phenotype Fish Conditions Figures
optic vesicle formation decreased process quality, abnormal WT + MO1-plxna2 standard conditions Fig. 1 with image from Ebert et al., 2014
whole organism shtn1 expression increased amount, abnormal WT + MO1-plxna2 standard conditions Fig. 4 with image from Emerson et al., 2017
whole organism rbl2 expression increased amount, abnormal WT + MO1-plxna2 standard conditions Fig. 4 with image from Emerson et al., 2017
whole organism mmp2 expression increased amount, abnormal WT + MO1-plxna2 standard conditions Fig. 4 with image from Emerson et al., 2017
midbrain physical object quality, abnormal WT + MO1-plxna2 standard conditions Fig. 1 with image from Ebert et al., 2014
optic vesicle cell mislocalised medially, abnormal WT + MO1-plxna2 standard conditions Fig. 1 with image from Ebert et al., 2014
optic vesicle regionalization decreased process quality, abnormal WT + MO1-plxna2 standard conditions Fig. 7 with image from Ebert et al., 2014
whole organism rasl11b expression increased amount, abnormal WT + MO1-plxna2 standard conditions Fig. 4 with image from Emerson et al., 2017
optic vesicle decreased size, abnormal WT + MO1-plxna2 standard conditions Fig. 1 with image from Ebert et al., 2014
eye decreased size, abnormal WT + MO1-plxna2 standard conditions Fig. 8 with image from Ebert et al., 2014
whole organism dcdc2b expression increased amount, abnormal WT + MO1-plxna2 standard conditions Fig. 4 with image from Emerson et al., 2017
optic vesicle shtn1 expression increased amount, abnormal WT + MO1-plxna2 + MO4-tp53 standard conditions Fig. 2 with image from Emerson et al., 2020
eye decreased size, abnormal zc7Tg + MO1-plxna2 standard conditions Fig. 7 from St Clair et al., 2017
optic vesicle GFP expression spatial pattern, abnormal zf460Tg + MO1-plxna2 standard conditions Fig. 2 with image from Emerson et al., 2020
optic vesicle cell mislocalised medially, abnormal zf460Tg + MO1-plxna2 standard conditions Fig. 2 with image from Ebert et al., 2014
optic vesicle formation decreased process quality, abnormal zf460Tg + MO1-plxna2 standard conditions Fig. 2 with imageFig. 3 with imageFig. 5 with image from Ebert et al., 2014
optic vesicle looseness, abnormal zf460Tg + MO1-plxna2 standard conditions Fig. 3 with image from Ebert et al., 2014
optic cup cell population proliferation decreased occurrence, abnormal zf460Tg + MO1-plxna2 standard conditions Fig. 1 with image from Emerson et al., 2017
eye decreased size, abnormal zf460Tg + MO1-plxna2 standard conditions Fig. 1 with image from Emerson et al., 2017
optic vesicle apoptotic process increased occurrence, abnormal zf460Tg + MO1-plxna2 standard conditions Fig. 4 with imageFig. 5 with image from Ebert et al., 2014
optic vesicle cell mislocalised, abnormal zf460Tg + MO1-plxna2 standard conditions Fig. 3 with imageFig. 4 with imageFig. 5 with image from Ebert et al., 2014
optic vesicle unstructured, abnormal zf460Tg + MO1-plxna2 standard conditions Fig. 4 with image from Ebert et al., 2014
optic vesicle decreased size, abnormal zf460Tg + MO1-plxna2 standard conditions Fig. 2 with imageFig. 5 with image from Ebert et al., 2014
optic vesicle edge shape, abnormal zf460Tg + MO1-plxna2 standard conditions Fig. 2 with image from Ebert et al., 2014
optic vesicle regionalization decreased process quality, abnormal WT + MO1-plxna2 + MO1-sema6a standard conditions Fig. 7 with image from Ebert et al., 2014
Citations