Morpholino

MO2-gba1

ID
ZDB-MRPHLNO-150422-2
Name
MO2-gba1
Previous Names
  • MO2-gba
Target
Sequence
5' - TAAGAGCACTCACCTGCACCTGTGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-gba1
Expressed Gene Anatomy Figures
col10a1a Fig. 1,  Fig. 5 from Zancan et al., 2015
gba1 Fig. 1 from Zancan et al., 2015
gpx1b Fig. 3 from Zancan et al., 2015
myb Fig. 2 from Zancan et al., 2015
plod1a Fig. 3 from Zancan et al., 2015
pon3.1 Fig. 3 from Zancan et al., 2015
runx2b Fig. 1 from Zancan et al., 2015
Phenotype
Phenotype resulting from MO2-gba1
Phenotype Fish Figures
canonical Wnt signaling pathway decreased occurrence, abnormal ia4Tg + MO2-gba1 Fig. 4 from Zancan et al., 2015
cellular response to oxidative stress increased occurrence, abnormal WT + MO2-gba1 Fig. 3 from Zancan et al., 2015
centrum bone mineralization decreased occurrence, abnormal WT + MO2-gba1 Fig. 1,  Fig. 5 from Zancan et al., 2015
ceratohyal bone bone mineralization decreased occurrence, abnormal WT + MO2-gba1 Fig. 5 from Zancan et al., 2015
cranium bone mineralization decreased occurrence, abnormal WT + MO2-gba1 Fig. 1 from Zancan et al., 2015
definitive hemopoiesis occurrence, abnormal WT + MO2-gba1 Fig. 2 from Zancan et al., 2015
endochondral ossification decreased occurrence, abnormal WT + MO2-gba1 Fig. 1 from Zancan et al., 2015
hematopoietic stem cell mislocalised, abnormal WT + MO2-gba1 Fig. 2 from Zancan et al., 2015
hematopoietic system has fewer parts of type thrombocyte, abnormal la2Tg + MO2-gba1 Fig. 2 from Zancan et al., 2015
hematopoietic system has fewer parts of type nucleate erythrocyte, abnormal sd2Tg + MO2-gba1 Fig. 2 from Zancan et al., 2015
intramembranous ossification decreased occurrence, abnormal WT + MO2-gba1 Fig. 1 from Zancan et al., 2015
liver increased size, abnormal gz15Tg + MO2-gba1 Fig. 2 from Zancan et al., 2015
opercle decreased volume, abnormal zf132Tg + MO2-gba1 Fig. 1,  Fig. 5 from Zancan et al., 2015
osteoblast differentiation decreased occurrence, abnormal WT + MO2-gba1 Fig. 1 from Zancan et al., 2015
thrombocyte differentiation decreased occurrence, abnormal la2Tg + MO2-gba1 Fig. 2 from Zancan et al., 2015
Phenotype of all Fish created by or utilizing MO2-gba1
Phenotype Fish Conditions Figures
osteoblast differentiation decreased occurrence, abnormal WT + MO2-gba1 standard conditions Fig. 1 from Zancan et al., 2015
endochondral ossification decreased occurrence, abnormal WT + MO2-gba1 standard conditions Fig. 1 from Zancan et al., 2015
cranium bone mineralization decreased occurrence, abnormal WT + MO2-gba1 standard conditions Fig. 1 from Zancan et al., 2015
centrum bone mineralization decreased occurrence, abnormal WT + MO2-gba1 standard conditions Fig. 1,  Fig. 5 from Zancan et al., 2015
intramembranous ossification decreased occurrence, abnormal WT + MO2-gba1 standard conditions Fig. 1 from Zancan et al., 2015
cellular response to oxidative stress increased occurrence, abnormal WT + MO2-gba1 standard conditions Fig. 3 from Zancan et al., 2015
ceratohyal bone bone mineralization decreased occurrence, abnormal WT + MO2-gba1 standard conditions Fig. 5 from Zancan et al., 2015
hematopoietic stem cell mislocalised, abnormal WT + MO2-gba1 standard conditions Fig. 2 from Zancan et al., 2015
definitive hemopoiesis occurrence, abnormal WT + MO2-gba1 standard conditions Fig. 2 from Zancan et al., 2015
opercle decreased volume, abnormal WT + MO2-gba1 standard conditions Fig. 5 from Zancan et al., 2015
liver increased size, abnormal gz15Tg + MO2-gba1 standard conditions Fig. 2 from Zancan et al., 2015
canonical Wnt signaling pathway decreased occurrence, abnormal ia4Tg + MO2-gba1 standard conditions Fig. 4 from Zancan et al., 2015
thrombocyte differentiation decreased occurrence, abnormal la2Tg + MO2-gba1 standard conditions Fig. 2 from Zancan et al., 2015
hematopoietic system has fewer parts of type thrombocyte, abnormal la2Tg + MO2-gba1 standard conditions Fig. 2 from Zancan et al., 2015
hematopoietic system has fewer parts of type nucleate erythrocyte, abnormal sd2Tg + MO2-gba1 standard conditions Fig. 2 from Zancan et al., 2015
opercle decreased volume, abnormal zf132Tg + MO2-gba1 standard conditions Fig. 1 from Zancan et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.