Morpholino

MO2-gba1

ID
ZDB-MRPHLNO-150422-2
Name
MO2-gba1
Previous Names
  • MO2-gba
Target
Sequence
5' - TAAGAGCACTCACCTGCACCTGTGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-gba1
Phenotype
Phenotype resulting from MO2-gba1
Phenotype Fish Figures
canonical Wnt signaling pathway decreased occurrence, abnormal ia4Tg + MO2-gba1 Fig. 4 from Zancan et al., 2015
cellular response to oxidative stress increased occurrence, abnormal WT + MO2-gba1 Fig. 3 from Zancan et al., 2015
centrum bone mineralization decreased occurrence, abnormal WT + MO2-gba1 Fig. 1Fig. 5 from Zancan et al., 2015
ceratohyal bone bone mineralization decreased occurrence, abnormal WT + MO2-gba1 Fig. 5 from Zancan et al., 2015
cranium bone mineralization decreased occurrence, abnormal WT + MO2-gba1 Fig. 1 from Zancan et al., 2015
definitive hemopoiesis occurrence, abnormal WT + MO2-gba1 Fig. 2 from Zancan et al., 2015
endochondral ossification decreased occurrence, abnormal WT + MO2-gba1 Fig. 1 from Zancan et al., 2015
hematopoietic stem cell mislocalised, abnormal WT + MO2-gba1 Fig. 2 from Zancan et al., 2015
hematopoietic system has fewer parts of type thrombocyte, abnormal la2Tg + MO2-gba1 Fig. 2 from Zancan et al., 2015
hematopoietic system has fewer parts of type nucleate erythrocyte, abnormal sd2Tg + MO2-gba1 Fig. 2 from Zancan et al., 2015
intramembranous ossification decreased occurrence, abnormal WT + MO2-gba1 Fig. 1 from Zancan et al., 2015
liver increased size, abnormal gz15Tg + MO2-gba1 Fig. 2 from Zancan et al., 2015
opercle decreased volume, abnormal WT + MO2-gba1 Fig. 1Fig. 5 from Zancan et al., 2015
osteoblast differentiation decreased occurrence, abnormal WT + MO2-gba1 Fig. 1 from Zancan et al., 2015
thrombocyte differentiation decreased occurrence, abnormal la2Tg + MO2-gba1 Fig. 2 from Zancan et al., 2015
Phenotype of all Fish created by or utilizing MO2-gba1
Phenotype Fish Conditions Figures
osteoblast differentiation decreased occurrence, abnormal WT + MO2-gba1 standard conditions Fig. 1 from Zancan et al., 2015
endochondral ossification decreased occurrence, abnormal WT + MO2-gba1 standard conditions Fig. 1 from Zancan et al., 2015
cranium bone mineralization decreased occurrence, abnormal WT + MO2-gba1 standard conditions Fig. 1 from Zancan et al., 2015
centrum bone mineralization decreased occurrence, abnormal WT + MO2-gba1 standard conditions Fig. 1Fig. 5 from Zancan et al., 2015
intramembranous ossification decreased occurrence, abnormal WT + MO2-gba1 standard conditions Fig. 1 from Zancan et al., 2015
cellular response to oxidative stress increased occurrence, abnormal WT + MO2-gba1 standard conditions Fig. 3 from Zancan et al., 2015
ceratohyal bone bone mineralization decreased occurrence, abnormal WT + MO2-gba1 standard conditions Fig. 5 from Zancan et al., 2015
hematopoietic stem cell mislocalised, abnormal WT + MO2-gba1 standard conditions Fig. 2 from Zancan et al., 2015
definitive hemopoiesis occurrence, abnormal WT + MO2-gba1 standard conditions Fig. 2 from Zancan et al., 2015
opercle decreased volume, abnormal WT + MO2-gba1 standard conditions Fig. 5 from Zancan et al., 2015
liver increased size, abnormal gz15Tg + MO2-gba1 standard conditions Fig. 2 from Zancan et al., 2015
canonical Wnt signaling pathway decreased occurrence, abnormal ia4Tg + MO2-gba1 standard conditions Fig. 4 from Zancan et al., 2015
thrombocyte differentiation decreased occurrence, abnormal la2Tg + MO2-gba1 standard conditions Fig. 2 from Zancan et al., 2015
hematopoietic system has fewer parts of type thrombocyte, abnormal la2Tg + MO2-gba1 standard conditions Fig. 2 from Zancan et al., 2015
hematopoietic system has fewer parts of type nucleate erythrocyte, abnormal sd2Tg + MO2-gba1 standard conditions Fig. 2 from Zancan et al., 2015
opercle decreased volume, abnormal zf132Tg + MO2-gba1 standard conditions Fig. 1 from Zancan et al., 2015
Citations