Morpholino
MO1-fmnl2a
- ID
- ZDB-MRPHLNO-150420-3
- Name
- MO1-fmnl2a
- Previous Names
- None
- Target
- Sequence
-
5' - GGTTTTGTGATTTACCTGGTAGTTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice-blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fmnl2a
No data available
Phenotype
Phenotype resulting from MO1-fmnl2a
No data available
Phenotype of all Fish created by or utilizing MO1-fmnl2a
1 - 5 of 7 Show all
Citations
- Lee, A.J., Raghavan, N.S., Bhattarai, P., Siddiqui, T., Sariya, S., Reyes-Dumeyer, D., Flowers, X.E., Cardoso, S.A.L., De Jager, P.L., Bennett, D.A., Schneider, J.A., Menon, V., Wang, Y., Lantigua, R.A., Medrano, M., Rivera, D., Jiménez-Velázquez, I.Z., Kukull, W.A., Brickman, A.M., Manly, J.J., Tosto, G., Kizil, C., Vardarajan, B.N., Mayeux, R. (2022) FMNL2 regulates gliovascular interactions and is associated with vascular risk factors and cerebrovascular pathology in Alzheimer's disease. Acta Neuropathologica. 144(1):59-79
- Wakayama, Y., Fukuhara, S., Ando, K., Matsuda, M., Mochizuki, N. (2015) Cdc42 Mediates Bmp-Induced Sprouting Angiogenesis through Fmnl3-Driven Assembly of Endothelial Filopodia in Zebrafish. Developmental Cell. 32:109-22
1 - 2 of 2
Show