Morpholino

MO3-mecom

ID
ZDB-MRPHLNO-150410-1
Name
MO3-mecom
Previous Names
None
Target
Sequence
5' - CTGAGTGACTTACATATGAAGGGCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-mecom
No data available
Phenotype
Phenotype resulting from MO3-mecom
Phenotype of all Fish created by or utilizing MO3-mecom
Phenotype Fish Conditions Figures
pronephric distal late tubule decreased length, abnormal WT + MO3-mecom standard conditions Fig. 6Fig. 8 from Morales et al., 2018
pronephric duct tbx2a expression decreased distribution, abnormal WT + MO3-mecom standard conditions Fig. 8 from Morales et al., 2018
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal WT + MO3-mecom standard conditions Fig. 6Fig. 8 from Morales et al., 2018
pronephric duct tbx2b expression decreased distribution, abnormal WT + MO3-mecom standard conditions Fig. 8 from Morales et al., 2018
pronephric duct emx1 expression decreased distribution, abnormal WT + MO3-mecom standard conditions Fig. 6 from Morales et al., 2018
pronephric distal late tubule decreased size, abnormal WT + MO3-mecom + MO4-mecom chemical treatment: all-trans-retinoic acid Fig. 5 with image from Li et al., 2014
pericardium edematous, abnormal WT + MO3-mecom + MO4-mecom standard conditions Fig. 2 with image from Li et al., 2014
pronephros multi-ciliated epithelial cell aggregated, abnormal WT + MO3-mecom + MO4-mecom chemical treatment: DAPT Fig. 7 with image from Li et al., 2014
pronephros multi-ciliated epithelial cell increased amount, abnormal WT + MO3-mecom + MO4-mecom chemical treatment: DAPT Fig. 7 with image from Li et al., 2014
pronephric distal late tubule decreased size, abnormal WT + MO3-mecom + MO4-mecom standard conditions Fig. 4 with imageFig. 5 with image from Li et al., 2014
pronephric proximal straight tubule distended, abnormal WT + MO3-mecom + MO4-mecom chemical treatment: all-trans-retinoic acid Fig. 5 with image from Li et al., 2014
pronephros multi-ciliated epithelial cell aggregated, abnormal WT + MO3-mecom + MO4-mecom standard conditions Fig. 7 with image from Li et al., 2014
pronephros multi-ciliated epithelial cell increased amount, abnormal WT + MO3-mecom + MO4-mecom standard conditions Fig. 7 with image from Li et al., 2014
whole organism anterior-posterior axis curved, abnormal WT + MO3-mecom + MO4-mecom standard conditions Fig. 2 with image from Li et al., 2014
blood accumulation heart, abnormal WT + MO3-mecom + MO4-mecom standard conditions Fig. S4 with image from Li et al., 2014
renal system process decreased process quality, abnormal WT + MO3-mecom + MO4-mecom standard conditions Fig. 2 with image from Li et al., 2014
pronephric proximal straight tubule distended, abnormal WT + MO3-mecom + MO4-mecom standard conditions Fig. 3 with imageFig. 5 with image from Li et al., 2014
Citations