ZFIN ID: ZDB-MRPHLNO-150402-7
Morpholino Name: MO3-pigp
Target: pigp (1)
Sequence:
5' - GACCACATACAGCACTGATGGAGAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Splice-blocking MO.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO3-pigp No data available
GENE EXPRESSION
Gene expression in Wild Types + MO3-pigp
Expressed Gene Anatomy Figures
ctslb Fig. 1 with image from Shao et al., 2009
dlx3b Fig. 1 with image from Shao et al., 2009
pcdh8 Fig. 1 with image from Shao et al., 2009
tbxta Fig. 1 with image from Shao et al., 2009
PHENOTYPE
Phenotype resulting from MO3-pigp
Phenotype of all Fish created by or utilizing MO3-pigp
Genome Resources:
CITATIONS (1)