ZFIN ID: ZDB-MRPHLNO-150402-5
Morpholino Name: MO1-pigp
Target: pigp (1)
Previous Name: dscr5 MO1 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GAGGAGAAGGAGAGTTCTCCACCAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-pigp No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-pigp
Expressed Gene Anatomy Figures
chrd Fig. 4 with image from Shao et al., 2009
ctslb Fig. 1 with image from Shao et al., 2009
dlx3b Fig. 1 with imageFig. 5 with imageFig. 7 with image from Shao et al., 2009
eve1 Fig. 4 with image from Shao et al., 2009
myod1 Fig. 7 with image from Shao et al., 2009
nkx2.1 Fig. 4 with image from Shao et al., 2009
nkx2.2a Fig. 4 with image from Shao et al., 2009
pcdh8 Fig. 1 with image from Shao et al., 2009
ptch1 Fig. 4 with image from Shao et al., 2009
tbxta Fig. 1 with imageFig. 4 with image from Shao et al., 2009
PHENOTYPE
Phenotype resulting from MO1-pigp
Phenotype of all Fish created by or utilizing MO1-pigp
Genome Resources:
CITATIONS (1)