Morpholino

MO2-her2

ID
ZDB-MRPHLNO-150402-2
Name
MO2-her2
Previous Names
None
Target
Sequence
5' - CTGGAAAGAGAAGGTAAAAGTTTGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-her2
Expressed Gene Anatomy Figures
ascl1a Fig. 6 with image from Cheng et al., 2015
ascl1b Fig. 6 with image from Cheng et al., 2015
dla Fig. 6 with image from Cheng et al., 2015
elavl3 Fig. 6 with image from Cheng et al., 2015
gfap Fig. 7 with image from Cheng et al., 2015
neurog1 Fig. 6 with image from Cheng et al., 2015
slc1a3a Fig. 7 with image from Cheng et al., 2015
sox2 Fig. 4 with image from Cheng et al., 2015
sox3 Fig. 4 with image from Cheng et al., 2015
Phenotype
Phenotype resulting from MO2-her2
Phenotype Fish Figures
brain malformed, abnormal TU + MO2-her2 Fig. 3 with image from Cheng et al., 2015
fourth ventricle edematous, abnormal TU + MO2-her2 Fig. 3 with image from Cheng et al., 2015
fourth ventricle increased size, abnormal TU + MO2-her2 Fig. 3 with image from Cheng et al., 2015
gliogenesis decreased process quality, abnormal TU + MO2-her2 Fig. 7 with image from Cheng et al., 2015
neural precursor cell proliferation decreased process quality, abnormal TU + MO2-her2 Fig. 4 with image from Cheng et al., 2015
neuron differentiation premature, abnormal TU + MO2-her2 Fig. 6 with image from Cheng et al., 2015
pericardium edematous, abnormal TU + MO2-her2 Fig. 3 with image from Cheng et al., 2015
third ventricle increased size, abnormal TU + MO2-her2 Fig. 3 with image from Cheng et al., 2015
trunk bent, abnormal TU + MO2-her2 Fig. 3 with image from Cheng et al., 2015
Phenotype of all Fish created by or utilizing MO2-her2
Phenotype Fish Conditions Figures
trunk bent, abnormal TU + MO2-her2 standard conditions Fig. 3 with image from Cheng et al., 2015
pericardium edematous, abnormal TU + MO2-her2 standard conditions Fig. 3 with image from Cheng et al., 2015
neural precursor cell proliferation decreased process quality, abnormal TU + MO2-her2 standard conditions Fig. 4 with image from Cheng et al., 2015
third ventricle increased size, abnormal TU + MO2-her2 standard conditions Fig. 3 with image from Cheng et al., 2015
fourth ventricle increased size, abnormal TU + MO2-her2 standard conditions Fig. 3 with image from Cheng et al., 2015
fourth ventricle edematous, abnormal TU + MO2-her2 standard conditions Fig. 3 with image from Cheng et al., 2015
brain malformed, abnormal TU + MO2-her2 standard conditions Fig. 3 with image from Cheng et al., 2015
gliogenesis decreased process quality, abnormal TU + MO2-her2 standard conditions Fig. 7 with image from Cheng et al., 2015
neuron differentiation premature, abnormal TU + MO2-her2 standard conditions Fig. 6 with image from Cheng et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.